ID: 1042683669

View in Genome Browser
Species Human (GRCh38)
Location 8:71414120-71414142
Sequence GAGCTACAGGCCAGGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683663_1042683669 0 Left 1042683663 8:71414097-71414119 CCCTACATAGTTATCCTGAGTAG No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683661_1042683669 13 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683660_1042683669 14 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683662_1042683669 12 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683664_1042683669 -1 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683669 Original CRISPR GAGCTACAGGCCAGGCCATC AGG Intronic