ID: 1042683672

View in Genome Browser
Species Human (GRCh38)
Location 8:71414143-71414165
Sequence CACCCATATCAATCAATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683663_1042683672 23 Left 1042683663 8:71414097-71414119 CCCTACATAGTTATCCTGAGTAG No data
Right 1042683672 8:71414143-71414165 CACCCATATCAATCAATAGTTGG No data
1042683664_1042683672 22 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683672 8:71414143-71414165 CACCCATATCAATCAATAGTTGG No data
1042683670_1042683672 -10 Left 1042683670 8:71414130-71414152 CCAGGCCATCAGGCACCCATATC No data
Right 1042683672 8:71414143-71414165 CACCCATATCAATCAATAGTTGG No data
1042683667_1042683672 9 Left 1042683667 8:71414111-71414133 CCTGAGTAGGAGCTACAGGCCAG No data
Right 1042683672 8:71414143-71414165 CACCCATATCAATCAATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683672 Original CRISPR CACCCATATCAATCAATAGT TGG Intronic