ID: 1042683675

View in Genome Browser
Species Human (GRCh38)
Location 8:71414150-71414172
Sequence ATCAATCAATAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683671_1042683675 -8 Left 1042683671 8:71414135-71414157 CCATCAGGCACCCATATCAATCA No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data
1042683664_1042683675 29 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data
1042683667_1042683675 16 Left 1042683667 8:71414111-71414133 CCTGAGTAGGAGCTACAGGCCAG No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data
1042683670_1042683675 -3 Left 1042683670 8:71414130-71414152 CCAGGCCATCAGGCACCCATATC No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data
1042683663_1042683675 30 Left 1042683663 8:71414097-71414119 CCCTACATAGTTATCCTGAGTAG No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683675 Original CRISPR ATCAATCAATAGTTGGATTC TGG Intronic