ID: 1042689596

View in Genome Browser
Species Human (GRCh38)
Location 8:71483399-71483421
Sequence GTGGCAAACCTGATTGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042689596 Original CRISPR GTGGCAAACCTGATTGTGAT TGG (reversed) Intronic
901032660 1:6316832-6316854 GTCCCAAACCTGAAAGTGATTGG + Intronic
908419589 1:63946939-63946961 CAGGCAAACCTGACTGTGAAAGG - Intronic
908671075 1:66548321-66548343 GTGGGAAAGCTGATGGAGATTGG + Intronic
908751194 1:67425103-67425125 GTGGCAAACGTGAATTTGATAGG - Exonic
910865000 1:91780219-91780241 GTGGTATTCCTGACTGTGATAGG - Intronic
912008206 1:104930212-104930234 GTGGTATACCTCATTATGATAGG + Intergenic
915681398 1:157585090-157585112 GAGGCAAGCCTGGTGGTGATGGG + Intronic
917232640 1:172854878-172854900 TTGGCATACCTGAAAGTGATGGG - Intergenic
921184706 1:212659527-212659549 TTGGCATACCTGAAAGTGATGGG + Intergenic
922606692 1:226894111-226894133 GTGGCCATCCTCATTGTGAGTGG + Exonic
924475143 1:244376277-244376299 GGGGTAACCTTGATTGTGATGGG - Intronic
1063115809 10:3070676-3070698 GGTGCATACGTGATTGTGATAGG + Intronic
1067828477 10:49596505-49596527 GTAACAAACCTGACTGTGTTGGG - Intergenic
1068271723 10:54736268-54736290 ATGGCAAACCTGATTCTGAAAGG - Intronic
1075304606 10:121356476-121356498 ATCGCAAACCCTATTGTGATAGG + Intergenic
1078008717 11:7552909-7552931 GAGGCAAATATGAATGTGATAGG - Intronic
1080091024 11:28349267-28349289 GTGGCCAATCTGATAGTGCTGGG + Intergenic
1082957968 11:58891835-58891857 GTTGCAATCTTGATTGTGCTGGG + Intronic
1088197850 11:107295218-107295240 TTGGCATACCTGAAAGTGATGGG + Intergenic
1093109080 12:15127479-15127501 ATTGCAAACCTGATTGAGAAAGG + Intronic
1093184105 12:16000064-16000086 GGGGCAAATTTGATTGTGCTTGG + Intronic
1093803304 12:23400357-23400379 GTGGCAAACTTGATGATGGTAGG - Intergenic
1095372375 12:41484521-41484543 GTGAAAAACCTCATTGTGGTGGG - Intronic
1097877656 12:64658329-64658351 GTGGAAAACCTCATGCTGATGGG - Intronic
1104247009 12:127053270-127053292 GTGGAAATCATGTTTGTGATGGG - Intergenic
1105516559 13:21095945-21095967 GTGGGAAACTTGATTGAGCTTGG + Intergenic
1109844261 13:67964456-67964478 ATGGCTAAACTGATTGCGATGGG - Intergenic
1110247514 13:73342987-73343009 GTGGCAAAAGTGATTGTTTTTGG + Intergenic
1114517546 14:23309471-23309493 CTGGCAAATCTGGTGGTGATGGG + Exonic
1115603908 14:34981759-34981781 GTGGGAAACCTGGTTCTGAGTGG - Intergenic
1115720943 14:36160840-36160862 TTGGCATACCTGAAAGTGATGGG - Intergenic
1118676212 14:68187424-68187446 GTGGGAAACCTGCTTGTTAGTGG + Intronic
1119204712 14:72785504-72785526 GAGGCAAAACTCATTGTGAGGGG - Intronic
1119814236 14:77550955-77550977 GTGGCACATCTGATTTTGGTTGG - Intronic
1120054974 14:79913532-79913554 GTGGCTAACCTGTTGGTTATAGG - Intergenic
1120089256 14:80312212-80312234 GTGGAAAACCTGCTGTTGATTGG + Intronic
1120853794 14:89195559-89195581 GAGGCATAGCTGATTGTGAAGGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126409495 15:48357448-48357470 GCTGCAAACCTAATTGGGATTGG - Intergenic
1130802487 15:87279933-87279955 TTGGCATACCTGAAAGTGATGGG - Intergenic
1134312771 16:13091416-13091438 TTGGCATACCTGAAAGTGATGGG - Intronic
1137346419 16:47666107-47666129 CTGGCAAACCTCAATGTCATAGG + Intronic
1140359280 16:74330973-74330995 GTGGGAAACCTCAGTGTGACTGG + Intergenic
1141339559 16:83190278-83190300 GTGGTACAGCTGATTGTCATGGG + Intronic
1147245648 17:39118629-39118651 GGGGCAAACGTCATTGGGATGGG - Intronic
1149460886 17:56829445-56829467 GTGGAAAAGCTCCTTGTGATGGG - Intronic
1156652161 18:39237251-39237273 GTGGCATACCTGAATGAGAAAGG + Intergenic
1160339626 18:78078254-78078276 GGGGCAAATATGATTTTGATGGG - Intergenic
925775293 2:7329405-7329427 GTGGAAAACCACATTTTGATGGG + Intergenic
927241876 2:20926333-20926355 GTGGAGAACAGGATTGTGATGGG + Intergenic
927532913 2:23825846-23825868 GTGGCAAACATAAATGTTATGGG - Intronic
930066454 2:47331597-47331619 GTGGCGACCTTGATTGTCATAGG - Intergenic
930374496 2:50547970-50547992 TTGGCAAAACTGATTGTAACTGG - Intronic
931427167 2:62181838-62181860 GAGGCAAACCTGCTTGTGTGAGG - Intergenic
932738703 2:74275161-74275183 GTGGCACAGCTGGTGGTGATGGG + Intronic
933765497 2:85705860-85705882 ATGGAAAACCTGAGTGTGCTTGG - Intergenic
935573835 2:104688880-104688902 GTGTCAAATCTGCTTCTGATGGG + Intergenic
937705590 2:124917134-124917156 TTGGGAAACCTGAATGTGGTAGG - Intergenic
942789770 2:179747388-179747410 GTGGCAAAAGTGACTGTGAGGGG - Intronic
944143240 2:196479499-196479521 GGGGCAATCTTGATTGTGACTGG - Intronic
945351503 2:208785787-208785809 TTGGCATACCTGAAAGTGATGGG + Intronic
947531125 2:230909200-230909222 GTGGACACCCTGATGGTGATAGG + Exonic
1169408249 20:5344217-5344239 ATGGGAAACCTGACTGTGGTGGG + Intergenic
1170069469 20:12349662-12349684 GTAGCAAATCTGACTGTGAATGG + Intergenic
1173188623 20:40859812-40859834 GTGTCAAACAGGATGGTGATGGG + Intergenic
949953061 3:9245386-9245408 GTTGCAAACCTCAGTGTCATTGG - Intronic
952219378 3:31309343-31309365 GAGGAAAACCTGCCTGTGATGGG - Intergenic
953914281 3:46908707-46908729 GAGGCAAACCTGAGTGTGTGCGG + Intergenic
954781437 3:53064861-53064883 ATGGCAAACGTGAATTTGATAGG - Intronic
957252294 3:77788582-77788604 TTGGCAAAGCAGATTGTGATTGG - Intergenic
962158990 3:132979172-132979194 GTGGCCATCCTGGTTTTGATGGG - Intergenic
967935520 3:194724457-194724479 GTGTCACACCTGAGTGAGATGGG + Intergenic
970033052 4:11699544-11699566 GAGGGAAAGCTGATTGTGTTAGG + Intergenic
971639216 4:29107632-29107654 GTAGGAAACCTGCTTCTGATGGG - Intergenic
971799975 4:31276153-31276175 GTGCCAAGTCAGATTGTGATAGG - Intergenic
973237502 4:47921649-47921671 TTGGCATACCTGAAGGTGATGGG - Intronic
973592914 4:52460476-52460498 TTGGCAAACCTGAAGGTAATGGG + Intergenic
974302218 4:60082812-60082834 TTGGCATACCTGAAAGTGATGGG + Intergenic
974399856 4:61389346-61389368 GTGGCAACCCTGTTTGTGATGGG + Intronic
974739006 4:65980180-65980202 GTGGAAAACCAGATGGTTATAGG + Intergenic
975640262 4:76493405-76493427 CTGGCAACCCTGATTCTGAGAGG + Intronic
975812212 4:78181462-78181484 GTGGCAAACGTGAATTTGATAGG - Intronic
976065704 4:81185002-81185024 GTGGTATACCTGAAAGTGATGGG + Intronic
976107067 4:81630500-81630522 GTTGCAAAACTGAATGTGAAAGG - Intronic
977630563 4:99238200-99238222 TTGGCATACCTGAAAGTGATGGG - Intergenic
981030426 4:140119911-140119933 GAGACAAACTTGATTGTGATTGG - Intronic
981296827 4:143141888-143141910 TTGGCATACCTGAATGTGACAGG + Intergenic
982139040 4:152299808-152299830 GTGGCAAATGTGGTTCTGATGGG - Intergenic
984200284 4:176711589-176711611 TTGGCAAAACTGATTGTTACTGG + Exonic
985282244 4:188298967-188298989 GAGTAAAAGCTGATTGTGATAGG - Intergenic
987854292 5:23398702-23398724 TTGGCAAAGCTGACTGAGATTGG + Intergenic
989480609 5:41925751-41925773 GTGGAAAACCTGAGGGCGATCGG - Intronic
989527042 5:42465730-42465752 GTGGCAAACGTGAATTTGATAGG - Intronic
991236848 5:64408402-64408424 TTGGCATACCTGAAAGTGATGGG + Intergenic
993602523 5:89946211-89946233 GTGGGAAACCTGAGTGTCAAAGG + Intergenic
994924506 5:106097443-106097465 GAGGCAACCATGATTGTGAAAGG + Intergenic
998190169 5:140016988-140017010 GTGGCAGACTTAAATGTGATTGG + Intronic
998867055 5:146515938-146515960 GTGGGAAACCTGTGTGTGATTGG - Exonic
1000190974 5:158910225-158910247 GTGGCCACCCTGTTTCTGATAGG - Intronic
1000843601 5:166252116-166252138 GTTTAAAACCTGATTGAGATGGG + Intergenic
1003705279 6:8521276-8521298 GAGGCCAACCTGATTGTGGTGGG - Intergenic
1005392201 6:25345062-25345084 GGTGCAAACTTGACTGTGATGGG - Intronic
1006173028 6:32106305-32106327 ATGGCAAACCTGAGTGTGAGGGG + Intronic
1008865574 6:56205509-56205531 TTGGCATACCTGAAAGTGATGGG + Intronic
1012582440 6:100885057-100885079 GTGGCAAATCTGATAATGAAAGG - Intergenic
1012944916 6:105455161-105455183 GTGGGAAAGGTGATTGTGAAAGG - Intergenic
1016224835 6:141722669-141722691 ATGGCAAACCTTAGTTTGATGGG + Intergenic
1017055625 6:150433352-150433374 GGTGCAAACCTGATTGGGATAGG - Intergenic
1019328392 7:450855-450877 GTGGCAGAGCTGATGGTGACAGG + Intergenic
1020757272 7:12218376-12218398 TTTCCAAACCAGATTGTGATGGG + Intronic
1025308606 7:57895105-57895127 TTGACAAACCTCGTTGTGATGGG + Intergenic
1039584625 8:38695713-38695735 GTGGGAAACCAGATTTTGGTGGG + Intergenic
1042689596 8:71483399-71483421 GTGGCAAACCTGATTGTGATTGG - Intronic
1043762151 8:84081479-84081501 TTGGCATACCTGAAAGTGATGGG - Intergenic
1045783838 8:105898555-105898577 TTGGCATACCTGAAAGTGATGGG + Intergenic
1047917101 8:129593981-129594003 GTGGAAACACTGATTCTGATGGG - Intergenic
1048510291 8:135055773-135055795 GTGGCAAAGCTGATAGGCATTGG + Intergenic
1052577055 9:30304144-30304166 TTGGGAAACCTAAATGTGATTGG + Intergenic
1057103981 9:92392980-92393002 GTGACAAACCTGAATGTGATAGG + Intronic
1057906561 9:98987920-98987942 GTGGCAGAGCTGAGTGTGATGGG + Intronic
1059827335 9:118045647-118045669 GAGGCAGCCCTGATGGTGATGGG - Intergenic
1061466592 9:130785389-130785411 GTGGCAAACATGCTTGTCAGAGG - Intronic
1186134076 X:6500495-6500517 GTAGCAAACCTCATTTAGATAGG - Intergenic
1191034701 X:56012260-56012282 GAAGCAAACTTGATTGTGGTGGG - Intergenic
1191041122 X:56080766-56080788 CTGGCATACCTGAAAGTGATGGG - Intergenic
1191657600 X:63614985-63615007 TTGGCATACCTGAAAGTGATAGG + Intergenic
1192160691 X:68784468-68784490 GTGGCAAACGTGAATTTGATAGG + Intergenic
1193343638 X:80381574-80381596 TTGGCATACCTGAAAGTGATGGG - Intronic