ID: 1042690212

View in Genome Browser
Species Human (GRCh38)
Location 8:71489985-71490007
Sequence TCACACTTGGCCCTGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042690212_1042690220 5 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690220 8:71490013-71490035 AGGACTGGATCCCAGGCCCTGGG No data
1042690212_1042690227 25 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data
1042690212_1042690219 4 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690219 8:71490012-71490034 CAGGACTGGATCCCAGGCCCTGG No data
1042690212_1042690222 12 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690222 8:71490020-71490042 GATCCCAGGCCCTGGGGAATAGG No data
1042690212_1042690216 -10 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690216 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
1042690212_1042690221 6 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data
1042690212_1042690217 -2 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690217 8:71490006-71490028 GATCTCCAGGACTGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042690212 Original CRISPR TCACACTTGGCCCTGGACCT TGG (reversed) Intronic