ID: 1042690215

View in Genome Browser
Species Human (GRCh38)
Location 8:71489998-71490020
Sequence CCAGTCCTGGAGATCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042690215_1042690222 -1 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690222 8:71490020-71490042 GATCCCAGGCCCTGGGGAATAGG No data
1042690215_1042690220 -8 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690220 8:71490013-71490035 AGGACTGGATCCCAGGCCCTGGG No data
1042690215_1042690227 12 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data
1042690215_1042690219 -9 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690219 8:71490012-71490034 CAGGACTGGATCCCAGGCCCTGG No data
1042690215_1042690221 -7 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042690215 Original CRISPR CCAGTCCTGGAGATCACACT TGG (reversed) Intronic