ID: 1042690215

View in Genome Browser
Species Human (GRCh38)
Location 8:71489998-71490020
Sequence CCAGTCCTGGAGATCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042690215_1042690220 -8 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG 0: 1
1: 0
2: 4
3: 18
4: 167
Right 1042690220 8:71490013-71490035 AGGACTGGATCCCAGGCCCTGGG No data
1042690215_1042690221 -7 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG 0: 1
1: 0
2: 4
3: 18
4: 167
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data
1042690215_1042690222 -1 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG 0: 1
1: 0
2: 4
3: 18
4: 167
Right 1042690222 8:71490020-71490042 GATCCCAGGCCCTGGGGAATAGG No data
1042690215_1042690219 -9 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG 0: 1
1: 0
2: 4
3: 18
4: 167
Right 1042690219 8:71490012-71490034 CAGGACTGGATCCCAGGCCCTGG No data
1042690215_1042690227 12 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG 0: 1
1: 0
2: 4
3: 18
4: 167
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042690215 Original CRISPR CCAGTCCTGGAGATCACACT TGG (reversed) Intronic
900391437 1:2435664-2435686 CCCCTCCTGGAGATCACAACAGG - Intronic
905323862 1:37136715-37136737 CCCATCCTGGAGATTAGACTTGG + Intergenic
905473550 1:38210160-38210182 CCAGTCCTGGAGAGGACACCTGG + Intergenic
905603618 1:39275741-39275763 AGAGTCCTGGAGGTCTCACTAGG - Intronic
906416372 1:45623486-45623508 CCAAACCTGTAGATCATACTTGG - Intronic
909722664 1:78794709-78794731 CCAGTCCTGGAGATGGTTCTTGG + Intergenic
914825089 1:151133961-151133983 CCACTCTTGGAGTTCACACTCGG - Exonic
916773766 1:167937638-167937660 CCACCCCTGGAAAACACACTTGG + Intronic
918139895 1:181711324-181711346 CCAATCCTGGAGCTGAGACTGGG + Intronic
921705970 1:218323522-218323544 CCAGTCCTGGGGACCAGAGTGGG - Intronic
923084727 1:230694740-230694762 CCAGTTCTGGAGTTCACTGTTGG + Intergenic
1066101559 10:32122675-32122697 CCAGTCCTGCAGACCAGAGTGGG - Intergenic
1067253568 10:44611303-44611325 CCATGCCTAGGGATCACACTGGG - Intergenic
1068648306 10:59493470-59493492 CCAGTTCTTGAGATTACAGTTGG - Intergenic
1070930540 10:80257618-80257640 GCTGTCCTAGAGATCACACTGGG + Intergenic
1071888120 10:89972607-89972629 CCAGTGCTGGAAGGCACACTTGG + Intergenic
1075483672 10:122802573-122802595 CAAGGCATGGAGACCACACTAGG + Intergenic
1075604773 10:123796770-123796792 CCAGCCCTGCACCTCACACTAGG + Intronic
1075643415 10:124081779-124081801 CCAGGCCGGGAGATCTCCCTGGG - Intronic
1076228852 10:128803292-128803314 CCAGTCATGGACATCTCACCAGG - Intergenic
1077583864 11:3435459-3435481 GCAGCCCTGGAGCTCACTCTCGG - Intergenic
1080326240 11:31076801-31076823 CAAGCCCTGGATCTCACACTGGG - Intronic
1084240770 11:67818132-67818154 GCAGCCCTGGAGCTCACTCTTGG - Intergenic
1088724811 11:112624630-112624652 CCCAGCCTGGAGTTCACACTTGG + Intergenic
1092217273 12:6692357-6692379 CAAGTGCCGGAGAGCACACTGGG - Intergenic
1093154177 12:15660562-15660584 CCAGTACTGGAGATCTAACCAGG + Intronic
1096115545 12:49052756-49052778 CAAATCCTAGAGAGCACACTGGG + Intronic
1099693456 12:85991379-85991401 CCAGTCCTGCAGACCAGACTGGG - Intronic
1101205347 12:102481710-102481732 CCAGGCCTGGAGAGCTCTCTAGG - Intergenic
1101426702 12:104594187-104594209 GCAGGGCTGGAGATCACACCTGG - Intronic
1103141799 12:118555046-118555068 CCAGGCCTGGAGCCCACAGTAGG + Intergenic
1104063920 12:125290878-125290900 ACGGTCCTGGAGATTACACAGGG - Intronic
1104588206 12:130064124-130064146 TCAGGCCTGGTGATAACACTGGG - Intergenic
1105706577 13:22971153-22971175 CCAGTCCTGGAGATCAGGCTTGG + Intergenic
1107658205 13:42613423-42613445 CCAGCCCTGCAGATCCCCCTGGG - Intergenic
1110643768 13:77856828-77856850 CCACCCCTGAACATCACACTGGG - Intergenic
1113707091 13:112441980-112442002 CCAGTCGTGGAGAGCACAACGGG - Intergenic
1117060775 14:51960836-51960858 ACAATCCTGGAGATCACATAGGG - Intronic
1119736339 14:76985075-76985097 CCAGGCCTGGAGATTGCCCTGGG - Intergenic
1120585780 14:86310911-86310933 CCATTGCTGCAGAACACACTGGG + Intergenic
1121606394 14:95243433-95243455 CCAGTACTGAAAATCACATTTGG + Intronic
1121695353 14:95908024-95908046 CCAGTCCTGCAGATCAAACTGGG - Intergenic
1122623072 14:103070724-103070746 CCGGTCCTGGAGACCCCACCAGG + Intergenic
1122849926 14:104522628-104522650 CTGGTCCTGGAGATCAGGCTTGG + Intronic
1125752374 15:42037243-42037265 CCAGTCCTGTAGATCAGAATGGG + Intronic
1126038831 15:44571357-44571379 CAATTCCTGGAGCTCAGACTAGG - Intronic
1128240096 15:66095890-66095912 CCAGTGCTGGAGAACCCAGTGGG + Intronic
1128263508 15:66249715-66249737 CTAGTTCTGGAGACCACACTTGG - Intronic
1129063743 15:72883478-72883500 AAATTCCTGGAGATCACACAAGG - Intergenic
1129363669 15:75041201-75041223 CCAGTCCTGGAGATGCCACTGGG - Intronic
1129918186 15:79293619-79293641 CCAGCCTTGAAGATCGCACTGGG + Exonic
1130725317 15:86432981-86433003 CCAGTCCTGGTGATCATATCAGG + Intronic
1131789799 15:95951791-95951813 CAAGTCTTGGACAACACACTTGG - Intergenic
1132149500 15:99449284-99449306 CTAGTCCTGGAGCTCAGGCTTGG + Intergenic
1134035688 16:11029268-11029290 CAATTCCTGGAGCTCACACTGGG - Intronic
1136989078 16:35140978-35141000 CCTGTCCTCGAGATCACAGGCGG - Intergenic
1136989619 16:35144063-35144085 CCTGTCCTTGAGATCACAGGGGG - Intergenic
1138820976 16:60259467-60259489 CAAGTCTTGGAAATCAAACTAGG + Intergenic
1139244986 16:65432926-65432948 GATGTCCTGGGGATCACACTTGG - Intergenic
1140269871 16:73456030-73456052 CCAGTCCTGGAGACCATATGTGG + Intergenic
1140864556 16:79048884-79048906 ACAGTTCTGGAGGTCACTCTGGG - Intronic
1141139617 16:81488791-81488813 CCCGTCTTCCAGATCACACTGGG - Intronic
1146569372 17:33939656-33939678 CCAGCCCTGGAGTCCACAGTGGG - Intronic
1146636869 17:34513033-34513055 CCAGTCCTAGGCACCACACTTGG - Intergenic
1147401168 17:40180838-40180860 CCAGTCCTGGTGAGGACACCTGG + Intronic
1148339415 17:46864399-46864421 CCAGTGCTTGAGAACATACTTGG - Intronic
1148495489 17:48051230-48051252 CCACTCCGGGAGATCATCCTGGG + Exonic
1150476331 17:65478685-65478707 TCAACCCTGGAGATGACACTGGG - Intergenic
1151405936 17:73886215-73886237 GCAGACCTGGAGAGCACTCTGGG - Intergenic
1152251746 17:79216118-79216140 CTGGTCCTGGACATCACAGTTGG + Intronic
1152660985 17:81541832-81541854 CCAGTGCTGCAGCCCACACTGGG - Intronic
1153006071 18:500038-500060 CCAGTCCCGGAGAAAACACCCGG + Intronic
1156509534 18:37624845-37624867 CTAGTCCTGGAGGTCACAGAGGG + Intergenic
1157095635 18:44683215-44683237 CCAGTTTTGGACATCACACAGGG + Intronic
1158549891 18:58426817-58426839 CCAGGCCTGGAGGTCACAGCTGG - Intergenic
1158844419 18:61426628-61426650 CCTGTCATGGAGAGAACACTGGG - Intronic
1160550313 18:79690760-79690782 ACACTCCTGGATATCACACCTGG - Intronic
1161143726 19:2664636-2664658 CCAGTCCTCTAGGTCACTCTGGG + Intronic
1162189818 19:8936110-8936132 CCAGTCCTGGAGTAGACACGAGG - Exonic
1162780785 19:13006125-13006147 CCAGTCCTTGAGATGGCGCTAGG + Intronic
1163417422 19:17195142-17195164 CCAGGCCTGGGGCTCCCACTGGG - Exonic
1167510160 19:49891529-49891551 CCGGGCCTGGAGCCCACACTCGG + Intronic
924982822 2:238590-238612 CCAGAGCTAGAGCTCACACTGGG - Intronic
925420615 2:3707722-3707744 CCAGTCCCTGAGACCACCCTTGG + Intronic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
933848045 2:86341353-86341375 CAATTCCTGGAGCTCACACAGGG + Intergenic
936466347 2:112754769-112754791 CCAGCCCTGGAGCTCAGCCTAGG - Intronic
936744707 2:115561046-115561068 CCAGTCCTTGAGATTTCAATAGG - Intronic
940151055 2:150601097-150601119 CAAATCCTGGAAATCAGACTAGG - Intergenic
944066020 2:195619855-195619877 AAAGTCCTGGAGGCCACACTTGG - Intronic
946397615 2:219451274-219451296 CCAGTGCTGGAGCTCACCTTGGG - Exonic
1169921700 20:10741019-10741041 CCAACCCTGGAGATCACTCAGGG + Intergenic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1174239755 20:49124113-49124135 ACAGCCCTGGCGATCACAGTGGG - Intronic
1179541484 21:42085843-42085865 CCAGGGCTGGAGAGCACCCTGGG + Intronic
1182101271 22:27659197-27659219 CCAGTCCTTTCGACCACACTGGG - Intergenic
1183973955 22:41499384-41499406 CCAGCTCTGGTGATCACACGGGG - Intronic
1185346091 22:50311446-50311468 CCAGTCCTGGAGCCCCCACCAGG - Exonic
949911134 3:8908992-8909014 CTTGTCCTAGAGATCACAATGGG + Intronic
953882717 3:46700001-46700023 CCAGTCAGGGAGGTCACCCTCGG - Intergenic
962266092 3:133945326-133945348 CCAGGCCAGGAACTCACACTGGG - Intronic
962363138 3:134758165-134758187 ACAGTCCTGGAGTTTACACTTGG - Intronic
962676366 3:137761401-137761423 CCAGGGCTGGAGATAACGCTTGG - Intergenic
963103526 3:141626264-141626286 CTAGTCTTGGGGACCACACTTGG - Intergenic
968456763 4:704323-704345 CCAGTGCTGGAGATCTCAGCAGG + Intergenic
968538671 4:1151151-1151173 CCAGTCCTGCAGACCAGAGTGGG - Intergenic
970262706 4:14245222-14245244 ACAGTCCTGGGGATTACACAGGG - Intergenic
970675507 4:18444403-18444425 CCAATCCTGGAGGTCACACAAGG + Intergenic
970825159 4:20263238-20263260 CCAGTCCAGCAGATAACACTTGG - Intronic
970922646 4:21413012-21413034 CCAGTCCTGCACATAACCCTGGG - Intronic
971751179 4:30650390-30650412 CAAGCCCAGGAGGTCACACTGGG - Intergenic
972158826 4:36198370-36198392 CTAGTCCTGCAGACCACAGTAGG - Intronic
974651510 4:64759343-64759365 CCAGTCCTGCAGACCAGAGTGGG + Intergenic
975913673 4:79297892-79297914 CCAGTCCTGCAGACCATAGTGGG + Intronic
977719692 4:100224648-100224670 CCAGAAAGGGAGATCACACTGGG - Intergenic
979295769 4:119031106-119031128 CCACTCCTGGAGACCAGACTGGG - Exonic
980450147 4:132959270-132959292 CCTGTCCTGCAGAACACAGTGGG + Intergenic
980730946 4:136823885-136823907 CCAGTCCTGTGGATCATAGTGGG - Intergenic
980752522 4:137110091-137110113 CCATGCCTGTAGATCTCACTTGG - Intergenic
981269575 4:142829393-142829415 CCAGTCCTGGGGACCTCACAGGG - Intronic
984978844 4:185257863-185257885 TCAGTCTTAGATATCACACTAGG - Intronic
986488423 5:8264515-8264537 CCAGTCCTGGAGATGGGACCTGG + Intergenic
990446720 5:55899931-55899953 CCAGTCCTAGAGAAAACACTTGG + Exonic
991359297 5:65803147-65803169 CCAGTCCTGCAGACCAGAGTGGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
994130215 5:96218818-96218840 GCAGGCCGGGAGAACACACTGGG + Intergenic
995495916 5:112742994-112743016 GCAGTCCTGGAGATCAGACACGG + Intronic
1000121483 5:158202082-158202104 GCATTCCTGGAGATCTCATTAGG + Intergenic
1000506631 5:162128161-162128183 CCTTTCCTGGAGATCACAGAAGG + Intronic
1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG + Intergenic
1009785100 6:68326711-68326733 TCATTCCTGGAGATTACAATTGG + Intergenic
1010179759 6:73072462-73072484 CCAATCCTTGAGTTCACAATAGG + Intronic
1011044807 6:83069149-83069171 CGAAGCCTGGAGATCACACCTGG - Intronic
1014342401 6:120226953-120226975 CCAGAGAGGGAGATCACACTGGG + Intergenic
1015455659 6:133424298-133424320 CCAGTCCTGCAGACCAGAGTGGG - Intronic
1017258970 6:152365124-152365146 CCAGCCCTGGAGCTCCCAGTCGG + Intronic
1019584122 7:1787461-1787483 CCAAGCCTGGGGACCACACTGGG - Intergenic
1020366387 7:7385051-7385073 GCAGTCCTGCATATCACTCTGGG - Intronic
1021575324 7:22101011-22101033 CAAGTCCTGAAGATAACAGTGGG - Intergenic
1021602339 7:22376851-22376873 CCAGTTCTGGTGAACACTCTGGG - Intergenic
1022526857 7:31043537-31043559 CAAGTCCTGGAGTCCACTCTAGG + Intergenic
1022859532 7:34352999-34353021 CCAGTACCTGAGATCACACGCGG - Intergenic
1023415819 7:39931376-39931398 CAAGTCCTAGAGGTCACACAGGG + Intergenic
1023699414 7:42877863-42877885 CCAGTCCTGCAGACCAGAGTGGG + Intergenic
1027055268 7:75045454-75045476 CCAGGCCTGGGGATCACACCTGG - Intronic
1028580880 7:92408624-92408646 CCGGTCCTTGAGAACACACGAGG - Intergenic
1029454768 7:100663527-100663549 CCAGTGTTGGAGACCACTCTAGG + Intergenic
1029936609 7:104431894-104431916 CCAGTCCTGGAGGTTTGACTGGG + Intronic
1032205687 7:129863105-129863127 CATGACCTGGAGAGCACACTTGG + Intronic
1037812461 8:22095162-22095184 CCCTTCCTGGAGTTCATACTGGG + Intronic
1038563926 8:28603787-28603809 TCAGTCCTGGAGAGCGCTCTGGG - Intronic
1039373871 8:37013870-37013892 CCAGGTCTGGAGAACACTCTTGG - Intergenic
1042690215 8:71489998-71490020 CCAGTCCTGGAGATCACACTTGG - Intronic
1044232001 8:89789357-89789379 ACTGTCCTGGAAATCACAGTTGG + Exonic
1044999933 8:97869885-97869907 CCAGTCCTGGAGACCCTACCAGG - Intronic
1046208831 8:111040848-111040870 CCAGTCCTGTAGACCACCCAAGG - Intergenic
1048911378 8:139138706-139138728 CCAGGCCTGGAATTCACATTGGG - Intergenic
1049650126 8:143762444-143762466 CCAGGCATGGACATCTCACTAGG + Intergenic
1050767702 9:9155764-9155786 GCAGTCCTGGTGATATCACTTGG + Intronic
1051541557 9:18225344-18225366 GCACTCGTGGAGATCCCACTGGG + Intergenic
1052866440 9:33467226-33467248 CCAGTTCTGGGGATCCCGCTCGG - Exonic
1054160239 9:61668105-61668127 CCTGTCCTAGAGATCACAGACGG - Intergenic
1056799921 9:89683847-89683869 CCAGTCCTGAAGATGAGCCTGGG - Intergenic
1057405849 9:94770084-94770106 CCATTCATGGACACCACACTGGG + Intronic
1058954023 9:109929232-109929254 CCAGTCCATGAGATCTCACATGG + Intronic
1059224635 9:112660158-112660180 CCAGACCGGGAGGTCACACCTGG - Exonic
1059433056 9:114261239-114261261 CCAGGCCTGGGGATCAGGCTTGG - Intronic
1059742268 9:117163476-117163498 CCATTCCTGGACAGCATACTGGG + Intronic
1060281166 9:122216633-122216655 CCAGTCCTGGAGAGATGACTTGG - Intronic
1060874964 9:127076732-127076754 CCAGTGCTGGTGATCACAACTGG - Intronic
1061130663 9:128706108-128706130 CCAGTTCTGGACATCATGCTGGG - Intronic
1061146966 9:128805728-128805750 CCAGCCCTGGTGCTCACACCTGG + Intronic
1061424910 9:130492813-130492835 CCAGACCTGCAGATCACTGTGGG - Intronic
1062026408 9:134342675-134342697 TCAGCCCTGGAGACCACACATGG - Intronic
1062201008 9:135302617-135302639 CCAGTCCTGGAGCTGGCACTTGG + Intergenic
1203666197 Un_KI270754v1:21959-21981 CCCGTCCTCGAGATCACAGACGG + Intergenic
1203667346 Un_KI270754v1:27598-27620 CCCGTCCTCGAGATCACAGACGG + Intergenic
1203668495 Un_KI270754v1:33237-33259 CCCGTCCTCGAGATCACAGACGG + Intergenic
1186781935 X:12921451-12921473 CCAGTCCTGGGGATCAAAGAGGG + Exonic
1188844803 X:35059556-35059578 CCCTTCATGAAGATCACACTCGG - Intergenic
1189268415 X:39733776-39733798 CCCTTCCTTGAGATCACACCTGG + Intergenic
1193082864 X:77422913-77422935 CCAGGCTTGGAGATCAGACCTGG - Intergenic
1193176422 X:78400355-78400377 CCAGTCCTGGAAATCTCAGCAGG + Intergenic
1194104630 X:89753565-89753587 CCAGTCTTGGAGGTTACATTTGG + Intergenic
1196483363 X:116177390-116177412 GCAGTCCAAGAGATCACACCTGG + Intergenic
1197796782 X:130306519-130306541 CCAGGGAGGGAGATCACACTGGG - Intergenic
1199975944 X:152895004-152895026 CCAGCCCTGGAGATCAGAATGGG + Intergenic
1200456584 Y:3401344-3401366 CCAGTCTTGGAGGTTACATTTGG + Intergenic
1200694433 Y:6346291-6346313 CAAGTCTTGCAGATCACATTAGG + Intergenic
1201040844 Y:9828419-9828441 CAAGTCTTGCAGATCACATTAGG - Intergenic