ID: 1042690221

View in Genome Browser
Species Human (GRCh38)
Location 8:71490014-71490036
Sequence GGACTGGATCCCAGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042690212_1042690221 6 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data
1042690213_1042690221 -1 Left 1042690213 8:71489992-71490014 CCAGGGCCAAGTGTGATCTCCAG No data
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data
1042690215_1042690221 -7 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690221 8:71490014-71490036 GGACTGGATCCCAGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042690221 Original CRISPR GGACTGGATCCCAGGCCCTG GGG Intronic