ID: 1042690227

View in Genome Browser
Species Human (GRCh38)
Location 8:71490033-71490055
Sequence GGGGAATAGGCATCTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042690213_1042690227 18 Left 1042690213 8:71489992-71490014 CCAGGGCCAAGTGTGATCTCCAG No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data
1042690218_1042690227 -1 Left 1042690218 8:71490011-71490033 CCAGGACTGGATCCCAGGCCCTG No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data
1042690212_1042690227 25 Left 1042690212 8:71489985-71490007 CCAAGGTCCAGGGCCAAGTGTGA No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data
1042690215_1042690227 12 Left 1042690215 8:71489998-71490020 CCAAGTGTGATCTCCAGGACTGG No data
Right 1042690227 8:71490033-71490055 GGGGAATAGGCATCTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042690227 Original CRISPR GGGGAATAGGCATCTCCCAG AGG Intronic