ID: 1042692440

View in Genome Browser
Species Human (GRCh38)
Location 8:71516381-71516403
Sequence GGTGAGAGAGGACAACTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042692436_1042692440 4 Left 1042692436 8:71516354-71516376 CCACAGTAGAGCTCTTGAAGGAT 0: 1
1: 0
2: 4
3: 11
4: 377
Right 1042692440 8:71516381-71516403 GGTGAGAGAGGACAACTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042692440 Original CRISPR GGTGAGAGAGGACAACTAGT TGG Intronic
No off target data available for this crispr