ID: 1042696506

View in Genome Browser
Species Human (GRCh38)
Location 8:71558848-71558870
Sequence CGTGTGCAAGCTCTGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042696506_1042696511 6 Left 1042696506 8:71558848-71558870 CCCTAATACAGAGCTTGCACACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1042696511 8:71558877-71558899 CCATGGCCATTGAATGAATGCGG No data
1042696506_1042696512 7 Left 1042696506 8:71558848-71558870 CCCTAATACAGAGCTTGCACACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1042696512 8:71558878-71558900 CATGGCCATTGAATGAATGCGGG No data
1042696506_1042696514 27 Left 1042696506 8:71558848-71558870 CCCTAATACAGAGCTTGCACACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1042696514 8:71558898-71558920 GGGACCGTTTGCGTTAATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042696506 Original CRISPR CGTGTGCAAGCTCTGTATTA GGG (reversed) Intronic
902745063 1:18468397-18468419 CGTGTCCCAGCTCTGTACTCTGG - Intergenic
905952117 1:41960664-41960686 CTTGTGCAAGATGTTTATTAAGG - Intronic
921297500 1:213718476-213718498 GCTTTGAAAGCTCTGTATTATGG + Intergenic
923695043 1:236240362-236240384 AGTGTGCAAGCTCTTTGCTACGG + Intronic
924400416 1:243674561-243674583 CCTGTGAAAGTTCTGTCTTATGG - Intronic
924558509 1:245137832-245137854 GGTGTGCCAGCTCTGTACTGGGG - Intergenic
924671377 1:246129634-246129656 TGTGTACAAGCTCTTTATTCAGG - Intronic
1063189340 10:3678979-3679001 TGTGTGTAAGGTATGTATTAGGG - Intergenic
1063189370 10:3679161-3679183 GGGGTGCAAGGTGTGTATTAGGG - Intergenic
1071996229 10:91152442-91152464 TGTGTGAAGGCTTTGTATTAAGG - Intergenic
1073982425 10:109169686-109169708 TGTGTGCAAACCCTGTGTTAGGG - Intergenic
1079201848 11:18383441-18383463 CGGGTGCAAGCTCTGGATCAAGG + Intergenic
1085812337 11:79695488-79695510 GGTGTGCAAGCTATGCATGATGG + Intergenic
1089021950 11:115225185-115225207 CGTTTGCAAGCTCATTAATAAGG - Intronic
1091462999 12:659920-659942 CATGTGCAAGGACTGTATAAAGG + Intronic
1091635643 12:2194434-2194456 CGTGAGTAAGCTATGTAATATGG - Intronic
1095692942 12:45111112-45111134 GGTGTGCAAGCTCAGGAGTAAGG - Intergenic
1096378203 12:51132328-51132350 AGTGTGCAAGTTCTGGTTTAGGG + Intronic
1099749412 12:86753303-86753325 CCTGAGCAATCTCTGTCTTAAGG + Intronic
1101788539 12:107907984-107908006 CAGGAGAAAGCTCTGTATTATGG + Intergenic
1103483892 12:121269642-121269664 GGTTTGCAACGTCTGTATTAGGG - Intronic
1112602803 13:100873202-100873224 GGTGTGCAGGCCCTGAATTATGG + Intergenic
1113465070 13:110507033-110507055 CGTGTGCATGCTCTTATTTAAGG + Intronic
1115542856 14:34439013-34439035 CTTGTGCAAGCTATTTATTGAGG + Intronic
1121655970 14:95595921-95595943 TGTGTGCAAGGATTGTATTAGGG + Intergenic
1129930851 15:79409751-79409773 CGAGTGACAGCTATGTATTATGG + Intronic
1135530423 16:23248422-23248444 CGTTTGCAACCTCTGGTTTAAGG - Intergenic
1148223800 17:45883989-45884011 GGTGTGCCATATCTGTATTAGGG + Intergenic
1155485241 18:26334548-26334570 CTTATGCCAGTTCTGTATTATGG + Intronic
1160418020 18:78725392-78725414 CCTGAACAAGCTCTGTATTTGGG - Intergenic
1164939044 19:32237604-32237626 CCTTTGCAATCTTTGTATTAGGG - Intergenic
1168408762 19:56125324-56125346 CATCTGAAAACTCTGTATTAGGG - Intergenic
928706825 2:33958625-33958647 CGTGTGCAGGCAATCTATTAAGG + Intergenic
929803367 2:45123342-45123364 CATGTGCTAGCTTTGTCTTAAGG + Intergenic
935539151 2:104328899-104328921 CCTGTGCAAGCTTCCTATTAAGG + Intergenic
939805813 2:146775059-146775081 CGTGTGCAAGCTGAGGATCAAGG - Intergenic
940321760 2:152384783-152384805 CGTGTGCAGGCTCTGGACCAGGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951214538 3:20011429-20011451 CGTGTGATAGAGCTGTATTATGG - Intronic
953823412 3:46229819-46229841 CGTGTGCAAGGAATATATTAAGG + Intronic
957143417 3:76390796-76390818 CATGTGCAACTTCTGTATTGTGG + Intronic
965748739 3:171954390-171954412 CCTATGCAAGCTGTGTACTAAGG - Intergenic
970349352 4:15185757-15185779 CGTTAGCAAGCTATGCATTAAGG - Intergenic
970700503 4:18731185-18731207 CCTGTGGAAGCCCAGTATTATGG + Intergenic
974429073 4:61772826-61772848 TGTGTCAGAGCTCTGTATTATGG + Intronic
976264006 4:83173295-83173317 CGTGAGCAATCTGTGTCTTAAGG - Intergenic
982803115 4:159728964-159728986 CAGGTCCAAGCTCTTTATTATGG - Intergenic
987554180 5:19424926-19424948 CGTGTGCAAGTTCGTTATAAGGG + Intergenic
988828853 5:34968454-34968476 CATGTGCATGCACTGTATGAGGG - Intergenic
991944285 5:71884504-71884526 CTTGGGCAAGCTCTGTGGTAAGG + Intergenic
994514338 5:100751944-100751966 TGTGTGCATTCTCTGTATTACGG + Intergenic
1000691072 5:164321363-164321385 GGTATGCAAGGTCTGTATTTTGG + Intergenic
1004022284 6:11786804-11786826 CGGGGGCAAGCTGTTTATTAAGG - Intronic
1004164735 6:13246707-13246729 CATGTGCAAGCTCTGTATAGGGG - Intronic
1009622077 6:66090295-66090317 TTTGTGGAAGTTCTGTATTATGG + Intergenic
1009835799 6:68999711-68999733 TGTGTGAAAGTTCTGTAGTACGG - Intronic
1014925548 6:127266639-127266661 AGTGTGCTTGCTTTGTATTAGGG - Exonic
1018113129 6:160556437-160556459 CATGTGCAAGCTCTTTCGTATGG + Intronic
1029021614 7:97370433-97370455 AGTGTGCAGGCTGTTTATTAGGG + Intergenic
1030477961 7:110061542-110061564 CATGAGAAAGCTCTGTGTTAAGG - Intergenic
1033289862 7:140074496-140074518 CTTGTGCAAGTTCTTTATTAAGG + Intergenic
1039421919 8:37450502-37450524 CGTGTGCCAGTGCTTTATTAGGG + Intergenic
1041805121 8:61841307-61841329 ATTGTGCAATCTCTGTAGTATGG - Intergenic
1042696506 8:71558848-71558870 CGTGTGCAAGCTCTGTATTAGGG - Intronic
1056852947 9:90099405-90099427 CGTGTGCATGCTGTGTGTTTTGG - Intergenic
1057735439 9:97654867-97654889 CCTGTGCAAGCTGTGAATTTAGG - Exonic
1059681955 9:116594291-116594313 TGTGCTCAAGCTCTGTTTTAGGG + Intronic
1185512770 X:675790-675812 CATGTCCCAGCTCTGTAATAGGG + Intergenic
1189286436 X:39855184-39855206 CGTGTGGAAGCAATTTATTAAGG - Intergenic
1195583799 X:106538710-106538732 TGTGTGCATGTTTTGTATTATGG + Intergenic
1201849065 Y:18457170-18457192 CCTTTGCAAGCTCTGTGTAATGG + Intergenic
1201884253 Y:18863205-18863227 CCTTTGCAAGCTCTGTGTAATGG - Intergenic