ID: 1042699828 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:71600122-71600144 |
Sequence | GTGGCTGCTCAGAAGTAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042699821_1042699828 | 10 | Left | 1042699821 | 8:71600089-71600111 | CCCTTATTTACAACAATTTCTCA | No data | ||
Right | 1042699828 | 8:71600122-71600144 | GTGGCTGCTCAGAAGTAGGAAGG | No data | ||||
1042699822_1042699828 | 9 | Left | 1042699822 | 8:71600090-71600112 | CCTTATTTACAACAATTTCTCAC | No data | ||
Right | 1042699828 | 8:71600122-71600144 | GTGGCTGCTCAGAAGTAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042699828 | Original CRISPR | GTGGCTGCTCAGAAGTAGGA AGG | Intergenic | ||
No off target data available for this crispr |