ID: 1042699828

View in Genome Browser
Species Human (GRCh38)
Location 8:71600122-71600144
Sequence GTGGCTGCTCAGAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042699821_1042699828 10 Left 1042699821 8:71600089-71600111 CCCTTATTTACAACAATTTCTCA No data
Right 1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG No data
1042699822_1042699828 9 Left 1042699822 8:71600090-71600112 CCTTATTTACAACAATTTCTCAC No data
Right 1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042699828 Original CRISPR GTGGCTGCTCAGAAGTAGGA AGG Intergenic
No off target data available for this crispr