ID: 1042700805

View in Genome Browser
Species Human (GRCh38)
Location 8:71611982-71612004
Sequence ACAGTCTGTAGAATAACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042700805_1042700807 -3 Left 1042700805 8:71611982-71612004 CCCAAAGTTATTCTACAGACTGT No data
Right 1042700807 8:71612002-71612024 TGTTATTTGACAGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042700805 Original CRISPR ACAGTCTGTAGAATAACTTT GGG (reversed) Intergenic
No off target data available for this crispr