ID: 1042703947

View in Genome Browser
Species Human (GRCh38)
Location 8:71647065-71647087
Sequence TTGGAGGTATAGCCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042703947_1042703953 -3 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703953 8:71647085-71647107 CAAATATAATCATTGCATTAGGG No data
1042703947_1042703960 27 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703960 8:71647115-71647137 CTTCAAAATATGAATTTTGGGGG No data
1042703947_1042703955 3 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703955 8:71647091-71647113 TAATCATTGCATTAGGGGCTAGG No data
1042703947_1042703956 4 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703956 8:71647092-71647114 AATCATTGCATTAGGGGCTAGGG No data
1042703947_1042703958 25 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703958 8:71647113-71647135 GGCTTCAAAATATGAATTTTGGG No data
1042703947_1042703954 -2 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703954 8:71647086-71647108 AAATATAATCATTGCATTAGGGG No data
1042703947_1042703959 26 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703959 8:71647114-71647136 GCTTCAAAATATGAATTTTGGGG 0: 6
1: 196
2: 989
3: 2518
4: 4081
1042703947_1042703952 -4 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703952 8:71647084-71647106 CCAAATATAATCATTGCATTAGG No data
1042703947_1042703957 24 Left 1042703947 8:71647065-71647087 CCTCCCAAAGGCTATACCTCCAA No data
Right 1042703957 8:71647112-71647134 GGGCTTCAAAATATGAATTTTGG 0: 7
1: 292
2: 1086
3: 2496
4: 3866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042703947 Original CRISPR TTGGAGGTATAGCCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr