ID: 1042704844

View in Genome Browser
Species Human (GRCh38)
Location 8:71655206-71655228
Sequence GCCTGTAATCACAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 832413
Summary {0: 1763, 1: 231601, 2: 276763, 3: 181923, 4: 140363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042704844_1042704854 24 Left 1042704844 8:71655206-71655228 CCCAAAGTGCTGTGATTACAGGC 0: 1763
1: 231601
2: 276763
3: 181923
4: 140363
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704844_1042704853 23 Left 1042704844 8:71655206-71655228 CCCAAAGTGCTGTGATTACAGGC 0: 1763
1: 231601
2: 276763
3: 181923
4: 140363
Right 1042704853 8:71655252-71655274 TCTGCTGTTCTTGAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042704844 Original CRISPR GCCTGTAATCACAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr