ID: 1042704844 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:71655206-71655228 |
Sequence | GCCTGTAATCACAGCACTTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 832413 | |||
Summary | {0: 1763, 1: 231601, 2: 276763, 3: 181923, 4: 140363} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042704844_1042704854 | 24 | Left | 1042704844 | 8:71655206-71655228 | CCCAAAGTGCTGTGATTACAGGC | 0: 1763 1: 231601 2: 276763 3: 181923 4: 140363 |
||
Right | 1042704854 | 8:71655253-71655275 | CTGCTGTTCTTGAGCTGAGAGGG | No data | ||||
1042704844_1042704853 | 23 | Left | 1042704844 | 8:71655206-71655228 | CCCAAAGTGCTGTGATTACAGGC | 0: 1763 1: 231601 2: 276763 3: 181923 4: 140363 |
||
Right | 1042704853 | 8:71655252-71655274 | TCTGCTGTTCTTGAGCTGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042704844 | Original CRISPR | GCCTGTAATCACAGCACTTT GGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |