ID: 1042704845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:71655207-71655229 |
| Sequence | TGCCTGTAATCACAGCACTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 794416 | |||
| Summary | {0: 859, 1: 98244, 2: 237885, 3: 243190, 4: 214238} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042704845_1042704853 | 22 | Left | 1042704845 | 8:71655207-71655229 | CCAAAGTGCTGTGATTACAGGCA | 0: 859 1: 98244 2: 237885 3: 243190 4: 214238 |
||
| Right | 1042704853 | 8:71655252-71655274 | TCTGCTGTTCTTGAGCTGAGAGG | No data | ||||
| 1042704845_1042704854 | 23 | Left | 1042704845 | 8:71655207-71655229 | CCAAAGTGCTGTGATTACAGGCA | 0: 859 1: 98244 2: 237885 3: 243190 4: 214238 |
||
| Right | 1042704854 | 8:71655253-71655275 | CTGCTGTTCTTGAGCTGAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042704845 | Original CRISPR | TGCCTGTAATCACAGCACTT TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||