ID: 1042704845

View in Genome Browser
Species Human (GRCh38)
Location 8:71655207-71655229
Sequence TGCCTGTAATCACAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 794416
Summary {0: 859, 1: 98244, 2: 237885, 3: 243190, 4: 214238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042704845_1042704853 22 Left 1042704845 8:71655207-71655229 CCAAAGTGCTGTGATTACAGGCA 0: 859
1: 98244
2: 237885
3: 243190
4: 214238
Right 1042704853 8:71655252-71655274 TCTGCTGTTCTTGAGCTGAGAGG No data
1042704845_1042704854 23 Left 1042704845 8:71655207-71655229 CCAAAGTGCTGTGATTACAGGCA 0: 859
1: 98244
2: 237885
3: 243190
4: 214238
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042704845 Original CRISPR TGCCTGTAATCACAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr