ID: 1042704847

View in Genome Browser
Species Human (GRCh38)
Location 8:71655237-71655259
Sequence ACAGCAGAACTGGCTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042704847_1042704853 -8 Left 1042704847 8:71655237-71655259 CCCCGCCCAGCCAGTTCTGCTGT No data
Right 1042704853 8:71655252-71655274 TCTGCTGTTCTTGAGCTGAGAGG No data
1042704847_1042704854 -7 Left 1042704847 8:71655237-71655259 CCCCGCCCAGCCAGTTCTGCTGT No data
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704847_1042704855 14 Left 1042704847 8:71655237-71655259 CCCCGCCCAGCCAGTTCTGCTGT No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042704847 Original CRISPR ACAGCAGAACTGGCTGGGCG GGG (reversed) Intergenic
No off target data available for this crispr