ID: 1042704854

View in Genome Browser
Species Human (GRCh38)
Location 8:71655253-71655275
Sequence CTGCTGTTCTTGAGCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042704844_1042704854 24 Left 1042704844 8:71655206-71655228 CCCAAAGTGCTGTGATTACAGGC 0: 1763
1: 231601
2: 276763
3: 181923
4: 140363
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704847_1042704854 -7 Left 1042704847 8:71655237-71655259 CCCCGCCCAGCCAGTTCTGCTGT No data
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704845_1042704854 23 Left 1042704845 8:71655207-71655229 CCAAAGTGCTGTGATTACAGGCA 0: 859
1: 98244
2: 237885
3: 243190
4: 214238
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704846_1042704854 -4 Left 1042704846 8:71655234-71655256 CCACCCCGCCCAGCCAGTTCTGC No data
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704849_1042704854 -9 Left 1042704849 8:71655239-71655261 CCGCCCAGCCAGTTCTGCTGTTC No data
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704848_1042704854 -8 Left 1042704848 8:71655238-71655260 CCCGCCCAGCCAGTTCTGCTGTT No data
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data
1042704842_1042704854 27 Left 1042704842 8:71655203-71655225 CCTCCCAAAGTGCTGTGATTACA 0: 2456
1: 309389
2: 266664
3: 148699
4: 131881
Right 1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042704854 Original CRISPR CTGCTGTTCTTGAGCTGAGA GGG Intergenic
No off target data available for this crispr