ID: 1042704855

View in Genome Browser
Species Human (GRCh38)
Location 8:71655274-71655296
Sequence GGAGCCCACTGTAGCATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042704849_1042704855 12 Left 1042704849 8:71655239-71655261 CCGCCCAGCCAGTTCTGCTGTTC No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704847_1042704855 14 Left 1042704847 8:71655237-71655259 CCCCGCCCAGCCAGTTCTGCTGT No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704848_1042704855 13 Left 1042704848 8:71655238-71655260 CCCGCCCAGCCAGTTCTGCTGTT No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704852_1042704855 4 Left 1042704852 8:71655247-71655269 CCAGTTCTGCTGTTCTTGAGCTG No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704850_1042704855 9 Left 1042704850 8:71655242-71655264 CCCAGCCAGTTCTGCTGTTCTTG No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704846_1042704855 17 Left 1042704846 8:71655234-71655256 CCACCCCGCCCAGCCAGTTCTGC No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data
1042704851_1042704855 8 Left 1042704851 8:71655243-71655265 CCAGCCAGTTCTGCTGTTCTTGA No data
Right 1042704855 8:71655274-71655296 GGAGCCCACTGTAGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042704855 Original CRISPR GGAGCCCACTGTAGCATCCT AGG Intergenic
No off target data available for this crispr