ID: 1042705753

View in Genome Browser
Species Human (GRCh38)
Location 8:71664425-71664447
Sequence CTGGGCAAAGGCTCCTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042705753_1042705762 16 Left 1042705753 8:71664425-71664447 CCAAAGAAGGAGCCTTTGCCCAG No data
Right 1042705762 8:71664464-71664486 TTTTTTTTTTTTGCAGGGTTGGG 0: 4
1: 23
2: 310
3: 3353
4: 17757
1042705753_1042705759 10 Left 1042705753 8:71664425-71664447 CCAAAGAAGGAGCCTTTGCCCAG No data
Right 1042705759 8:71664458-71664480 TTTTTTTTTTTTTTTTTTGCAGG 0: 421
1: 4441
2: 30482
3: 124908
4: 135524
1042705753_1042705760 11 Left 1042705753 8:71664425-71664447 CCAAAGAAGGAGCCTTTGCCCAG No data
Right 1042705760 8:71664459-71664481 TTTTTTTTTTTTTTTTTGCAGGG 0: 134
1: 1316
2: 14375
3: 131799
4: 143066
1042705753_1042705761 15 Left 1042705753 8:71664425-71664447 CCAAAGAAGGAGCCTTTGCCCAG No data
Right 1042705761 8:71664463-71664485 TTTTTTTTTTTTTGCAGGGTTGG No data
1042705753_1042705763 26 Left 1042705753 8:71664425-71664447 CCAAAGAAGGAGCCTTTGCCCAG No data
Right 1042705763 8:71664474-71664496 TTGCAGGGTTGGGTGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042705753 Original CRISPR CTGGGCAAAGGCTCCTTCTT TGG (reversed) Intergenic
No off target data available for this crispr