ID: 1042711600

View in Genome Browser
Species Human (GRCh38)
Location 8:71723391-71723413
Sequence TCAGAGCCACAAATTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042711600_1042711604 16 Left 1042711600 8:71723391-71723413 CCTTTCCCAATTTGTGGCTCTGA No data
Right 1042711604 8:71723430-71723452 TACACCTGTATGGCCACAGCTGG No data
1042711600_1042711603 6 Left 1042711600 8:71723391-71723413 CCTTTCCCAATTTGTGGCTCTGA No data
Right 1042711603 8:71723420-71723442 AAAGTGTGTCTACACCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042711600 Original CRISPR TCAGAGCCACAAATTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr