ID: 1042713846

View in Genome Browser
Species Human (GRCh38)
Location 8:71749864-71749886
Sequence CCACTTAAGAAGCTCTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042713846_1042713851 -7 Left 1042713846 8:71749864-71749886 CCCAGTAAGAGCTTCTTAAGTGG No data
Right 1042713851 8:71749880-71749902 TAAGTGGAGGAATGATCTGAGGG No data
1042713846_1042713850 -8 Left 1042713846 8:71749864-71749886 CCCAGTAAGAGCTTCTTAAGTGG No data
Right 1042713850 8:71749879-71749901 TTAAGTGGAGGAATGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042713846 Original CRISPR CCACTTAAGAAGCTCTTACT GGG (reversed) Intergenic
No off target data available for this crispr