ID: 1042721359

View in Genome Browser
Species Human (GRCh38)
Location 8:71830233-71830255
Sequence TTAGTTCAGCACATATAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042721358_1042721359 5 Left 1042721358 8:71830205-71830227 CCTAAGTGAGAATAGATCTATTT 0: 1
1: 0
2: 1
3: 15
4: 250
Right 1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042721359 Original CRISPR TTAGTTCAGCACATATAAAT TGG Intronic
No off target data available for this crispr