ID: 1042721436

View in Genome Browser
Species Human (GRCh38)
Location 8:71830867-71830889
Sequence GTACATAATCTGATGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042721436_1042721438 1 Left 1042721436 8:71830867-71830889 CCTAGCACCATCAGATTATGTAC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1042721438 8:71830891-71830913 GCAGAAATAGTAGTGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042721436 Original CRISPR GTACATAATCTGATGGTGCT AGG (reversed) Intronic
901487001 1:9571006-9571028 GAAAATCATCTGATGGGGCTGGG - Intronic
901648313 1:10728334-10728356 GTCCATAAAATGATGGTGCGTGG - Intronic
904450473 1:30607828-30607850 TTACATGATCTGAGGGTGCATGG - Intergenic
918839381 1:189514355-189514377 TTACATAATCTCATAGTTCTCGG - Intergenic
1065648983 10:27867332-27867354 CCACAAAGTCTGATGGTGCTGGG + Intronic
1066063202 10:31742567-31742589 GTCCAAAATGTGATGGTGGTAGG - Intergenic
1068351280 10:55848673-55848695 ATATATAAGCTGATGGGGCTAGG - Intergenic
1070143813 10:73759376-73759398 GTACTTGACCTGAAGGTGCTTGG + Intronic
1072608154 10:97000586-97000608 CTACAGAATCTGCTGGTGGTAGG - Exonic
1073546281 10:104352297-104352319 GTACACAATCTTAAAGTGCTTGG + Intergenic
1078739033 11:14049454-14049476 GGACTTTATCTGAAGGTGCTGGG - Intronic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1085704475 11:78774023-78774045 GTAAGTAAAATGATGGTGCTAGG - Intronic
1087567587 11:99881723-99881745 GTACAGAAGCTGCTAGTGCTGGG + Intronic
1087674688 11:101146765-101146787 GTAAATACTTTGATGTTGCTGGG - Intergenic
1090128367 11:124114114-124114136 GTTCATCATCTGATCCTGCTGGG - Intergenic
1091079562 11:132654099-132654121 GGACAAAAGCTGATGCTGCTGGG + Intronic
1092609993 12:10162501-10162523 TTACATAATATGATGGGGTTAGG - Intronic
1095119560 12:38400680-38400702 GTACATAATCTGGTAGTGAGGGG - Intergenic
1095810013 12:46363425-46363447 TTACATAGTCTGAAGGTGATGGG + Intronic
1098123244 12:67264947-67264969 GTAGATATTATGATGGTGCATGG - Intergenic
1101808535 12:108087243-108087265 ATACATATTCTGATGATGGTAGG - Intergenic
1102713834 12:114952757-114952779 GTTCACTATCTGATGGTGCCAGG - Intergenic
1111145138 13:84169447-84169469 TTACATAATCTCATGTTTCTTGG + Intergenic
1112113061 13:96323827-96323849 GTATATATTCTGCTGGTGGTGGG - Intronic
1113219656 13:108085281-108085303 ATATATAAGCTGATGGGGCTGGG - Intergenic
1114678188 14:24459628-24459650 TTACATACTCTGACAGTGCTGGG + Intergenic
1116643739 14:47499600-47499622 GTATATAAGCTGATAGTGGTAGG - Intronic
1117204095 14:53423594-53423616 GTAAACAAACTGATGGGGCTTGG - Intergenic
1118439185 14:65797775-65797797 TTACAAATTCTGATGGTGATGGG + Intergenic
1121466512 14:94118908-94118930 GTGAATAATCTGAAGGAGCTTGG + Intergenic
1123020435 14:105395475-105395497 GTACATAGTGAGATGCTGCTGGG + Exonic
1125254404 15:37746213-37746235 TTACATAATCTCATGTTTCTTGG - Intergenic
1125285111 15:38084092-38084114 GTACATAATCAATTGATGCTGGG - Intergenic
1125867481 15:43066257-43066279 GTCAATAATCAGATGGTTCTAGG + Intronic
1134072184 16:11267203-11267225 GCATAGAATCTGAAGGTGCTGGG - Intronic
1134388728 16:13798344-13798366 GTACATCACCAGAAGGTGCTTGG + Intergenic
1147442514 17:40456132-40456154 GTACATATTCTGATTGGGTTGGG - Intronic
1149427763 17:56571136-56571158 TTACATAAAATGATGGTGCAGGG - Intergenic
1157356160 18:46936442-46936464 CTACATAACCTGGGGGTGCTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160458513 18:79019730-79019752 GTCCCTAAGGTGATGGTGCTAGG + Intergenic
1163199708 19:15757691-15757713 GTACATAATCTTATATTTCTTGG + Intergenic
1163926899 19:20354343-20354365 GTAAAAAATCTGATGGTTGTAGG - Intergenic
1167758483 19:51427958-51427980 TTATATAAGCTGATGGGGCTGGG - Intergenic
926172207 2:10559408-10559430 GTAAAGAATCTGATGGTGCCTGG + Intergenic
929256465 2:39816258-39816280 TTACATAATCTCATGTTTCTCGG + Intergenic
930424184 2:51192916-51192938 GTACATAATCCCATGTTTCTTGG + Intergenic
932386509 2:71338479-71338501 GTAAATGTTTTGATGGTGCTAGG - Intronic
933465600 2:82647016-82647038 GTCAATAATCAGATGGTTCTAGG - Intergenic
934296932 2:91749627-91749649 GGACAGGATCTGGTGGTGCTGGG - Intergenic
936750300 2:115633943-115633965 TTACATAATCTCATAGTTCTTGG + Intronic
939301111 2:140340451-140340473 GTGAATAATTTGTTGGTGCTTGG + Intronic
939881515 2:147636568-147636590 GTTCATAAGATGTTGGTGCTGGG - Intergenic
940037521 2:149326850-149326872 GTAGATAATCTGCTATTGCTAGG - Intergenic
943606386 2:189982165-189982187 TTACATAATCTCATGTTTCTTGG + Intronic
1168733170 20:104806-104828 GTACATAATCTCATATTTCTTGG - Intergenic
1175374222 20:58513897-58513919 ATTCATAATGTGAGGGTGCTTGG + Intronic
1183308101 22:37094120-37094142 GGACTTAATCAGATGATGCTTGG - Intronic
949559111 3:5186803-5186825 GTAAATAATTTGGTGGTGGTGGG + Intergenic
951000861 3:17557931-17557953 GTTCATAACATGATTGTGCTGGG - Intronic
952763404 3:36935022-36935044 GCACATGATCTGATGGTCTTGGG - Intronic
959883386 3:111472555-111472577 TTACATAATCTCATAGTTCTAGG + Intronic
966289029 3:178333474-178333496 TTACATAATCTCATGTTTCTTGG + Intergenic
967222458 3:187258884-187258906 GAACATATTCTGGTGGTGGTAGG + Intronic
967298392 3:187987769-187987791 GTATAAAATCTGAGGCTGCTAGG - Intergenic
968501930 4:954394-954416 GGACATCAGCTGTTGGTGCTTGG + Intronic
970372746 4:15424492-15424514 GTACAGAATCTGAGGCTGGTGGG - Intronic
970404295 4:15747506-15747528 GTAAAGAATGTGATGGTGATGGG - Intergenic
973736143 4:53873336-53873358 CTACAGAATCTGATGGTAGTAGG + Intronic
974581798 4:63813461-63813483 TTACATAATCTCATAGTTCTTGG + Intergenic
974908346 4:68084150-68084172 TTACATAATCTCATGTTTCTTGG - Intronic
977735303 4:100407884-100407906 TTACATAATCTCATGTTTCTTGG + Intronic
980721135 4:136697066-136697088 ATAAATAATCTGATGAGGCTGGG + Intergenic
981063112 4:140448361-140448383 GTACATAATCTCATATTTCTTGG + Intronic
984628432 4:182035042-182035064 TTACATAGTCTCATGGTTCTTGG + Intergenic
988539557 5:32096802-32096824 GTACATAATTTGATCATGATGGG - Intronic
989534782 5:42550884-42550906 GAACATAACCTGAGGGTGCCGGG - Intronic
993054197 5:82962646-82962668 AGACATAATCTTCTGGTGCTGGG - Intergenic
1000925668 5:167191036-167191058 GTACATCAATTAATGGTGCTGGG + Intergenic
1006240967 6:32678720-32678742 TTACATAATCTCATAGTTCTTGG + Intergenic
1007824726 6:44591699-44591721 AAACATAATGTGATTGTGCTGGG + Intergenic
1007945374 6:45821909-45821931 GTAAATTATCTGATGGGCCTGGG + Intergenic
1008227719 6:48942036-48942058 GTTAATAATGTGATGATGCTTGG - Intergenic
1010032738 6:71288317-71288339 GGACAAAAGCTGATGGTGCCGGG - Intergenic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1014564239 6:122929226-122929248 TTACATAATCTCATGTTTCTTGG + Intergenic
1015368434 6:132424195-132424217 TTACATAATCTCATAGTTCTTGG + Intergenic
1016533533 6:145085532-145085554 GTAAATAAAATGATGGTGGTCGG + Intergenic
1017440439 6:154459988-154460010 GTACAGAATCTGTTGGGGTTGGG - Intronic
1017529284 6:155272380-155272402 GTTCATAAACTGAAGGTGCCTGG + Intronic
1023296695 7:38722332-38722354 GCCCATGATCTGATGGTGGTGGG + Intergenic
1024531243 7:50394209-50394231 CTGCATAATCTGTTGGTGCTTGG + Intronic
1025194399 7:56921530-56921552 GTGCATAATGTGATGGTTTTGGG + Intergenic
1025677553 7:63655423-63655445 GTGCATAATGTGATGGTTTTGGG - Intergenic
1026001751 7:66564874-66564896 GGTCATAATTTGATGGTACTTGG - Intergenic
1026054915 7:66975557-66975579 TTACATAATCTGAGGGTTCCAGG + Intergenic
1030808704 7:113948320-113948342 TTACATAATCTGATGTTTCTTGG - Intronic
1042721436 8:71830867-71830889 GTACATAATCTGATGGTGCTAGG - Intronic
1046829028 8:118723533-118723555 GTATATAATCTCCTGGTGCGTGG + Intergenic
1051136642 9:13930219-13930241 CTGAATAATCTGATGTTGCTTGG - Intergenic
1051703863 9:19855946-19855968 TTACATAATCTCATAGTTCTTGG + Intergenic
1059553894 9:115259141-115259163 GTACATTATCTCATGGTGGAAGG - Intronic
1061885799 9:133590573-133590595 GAACATTATCTCAAGGTGCTGGG - Intergenic
1186940118 X:14497506-14497528 GTACAAAATGTGGTGGTCCTGGG + Intergenic
1190412120 X:50147094-50147116 TTAGGTAATCTGATGGTTCTTGG - Intergenic
1194188519 X:90806544-90806566 TTACATAATCTCATGTTTCTTGG + Intergenic
1197194643 X:123686145-123686167 GTTCATAGTCTGATGTGGCTGGG - Intronic
1197240099 X:124114377-124114399 GTCCAGAATCTGAGGCTGCTCGG + Intronic
1198618999 X:138486110-138486132 GCACATAATATGCTGGTTCTTGG + Intergenic
1199775484 X:151007455-151007477 GTGCATAATTTGATGGTTTTTGG - Intergenic
1200316616 X:155139332-155139354 GTACATCACCTCATGGTGCACGG + Intronic
1200535108 Y:4388440-4388462 TTACATAATCTCATGTTTCTTGG + Intergenic
1201760511 Y:17531967-17531989 GTACCAAATGGGATGGTGCTAGG + Intergenic
1201841043 Y:18374023-18374045 GTACCAAATGGGATGGTGCTAGG - Intergenic