ID: 1042733433

View in Genome Browser
Species Human (GRCh38)
Location 8:71962248-71962270
Sequence CCACATTCTGAGTCACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042733433_1042733439 9 Left 1042733433 8:71962248-71962270 CCCTGCAGTGACTCAGAATGTGG 0: 1
1: 0
2: 0
3: 16
4: 209
Right 1042733439 8:71962280-71962302 GGCTTTCTGAGACCTCAGTTCGG No data
1042733433_1042733441 30 Left 1042733433 8:71962248-71962270 CCCTGCAGTGACTCAGAATGTGG 0: 1
1: 0
2: 0
3: 16
4: 209
Right 1042733441 8:71962301-71962323 GGCTCCTCCCCTCGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042733433 Original CRISPR CCACATTCTGAGTCACTGCA GGG (reversed) Intronic
902533615 1:17106172-17106194 CCACCTTCTGAGTCATTTCTTGG + Intronic
905447622 1:38037483-38037505 CCACATTCTTAGGCGCTACATGG + Intergenic
906110074 1:43316857-43316879 CCACAATGTGAGTCAATGGAAGG - Intronic
908205010 1:61837875-61837897 CAATATTCTGAGTCACTGACCGG - Intronic
908656039 1:66389871-66389893 CCCCATTCTGAGTCCATGAAGGG - Intergenic
911120530 1:94292380-94292402 CCACATTCTAACTCATCGCAAGG - Intergenic
911892978 1:103396318-103396340 GCACATTCTAACTTACTGCAAGG - Intergenic
912738101 1:112168053-112168075 CCAAATTCTTTGTTACTGCACGG - Intergenic
913057991 1:115179640-115179662 CTGCATTCTGAGTCACCGCCTGG - Intergenic
913430970 1:118789970-118789992 GCACATTCTAACTCAATGCAAGG + Intergenic
916117869 1:161503175-161503197 CCACATCCTGAGTGACTCCTAGG - Intergenic
917997993 1:180460965-180460987 GCACATTCTAACTCAGTGCAAGG + Intronic
918075334 1:181166676-181166698 CCACATGCAGAGCCACTACAGGG - Intergenic
920324462 1:205151803-205151825 CCACATTCTGTCCCACTGGAAGG + Intronic
920445606 1:206013880-206013902 CCACCTTCTGGGTTACTACATGG + Exonic
920764855 1:208822566-208822588 CCACAAGGTGAGTCACTGGAAGG - Intergenic
922168489 1:223135392-223135414 CTCCATTCTGAGTCAGGGCAGGG + Intronic
922572371 1:226641803-226641825 CCACATTCTGAGCCTGTGCCTGG + Intronic
924568526 1:245218022-245218044 CCAAATACTGAGTCACCGCATGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063953746 10:11247346-11247368 CCACTTCCTGGGTCACTGCGGGG + Intronic
1064159507 10:12931825-12931847 CCAGATTCAGAGCCCCTGCATGG - Intronic
1065219860 10:23485624-23485646 CAGCCTTCTGAGTCACTGCTGGG + Intergenic
1066592007 10:37005891-37005913 CCATCTCCTGAGTCTCTGCAAGG + Intergenic
1074402280 10:113152002-113152024 CCACATTCTGAATCCTTGAATGG + Intronic
1075310248 10:121407668-121407690 CCACATTCTGAGTTTCTGGATGG - Intergenic
1075311279 10:121415853-121415875 CCACAGTCTCAGCCACTGGAGGG + Intergenic
1075461359 10:122618568-122618590 CCCCATCCTGAGGCAGTGCAAGG + Intronic
1076764445 10:132625359-132625381 CCAGCTTCTGAGTCAATGCCTGG + Intronic
1078100527 11:8327917-8327939 CCACATTCTGAGTCATCTCAGGG - Intergenic
1079498191 11:21070102-21070124 CTACTTACTGAGTCACTCCAAGG + Intronic
1082781038 11:57287576-57287598 TCACATTCTGAGGCACTGGGGGG - Intergenic
1084747989 11:71185423-71185445 CCACATTCTGAGTAATGGCCAGG + Intronic
1085204326 11:74721455-74721477 CCACATTCTCAGCCTCTGCCAGG - Intronic
1085896226 11:80642647-80642669 CCATCTCCTGAGTCTCTGCAAGG - Intergenic
1087420081 11:97911617-97911639 CCACATTCTGAGTTACTAGGGGG + Intergenic
1088750968 11:112841848-112841870 CCACATCCTGAGTCCCTTCAGGG + Intergenic
1089115623 11:116092801-116092823 CCACTTACTGTGGCACTGCAGGG + Intergenic
1090345811 11:126069536-126069558 ACACAGAGTGAGTCACTGCAGGG - Intergenic
1091738237 12:2940894-2940916 CCCCATCCTGAGGCACTGCCTGG + Exonic
1093766203 12:22965961-22965983 CCACACTCTGAGTCTCTGGAAGG + Intergenic
1098210763 12:68162566-68162588 CCAACCTCTGAGTCACTGGAAGG + Intergenic
1100819301 12:98416451-98416473 CCTCTTTCTGAGACACTTCATGG - Intergenic
1102504517 12:113375101-113375123 CAACACACGGAGTCACTGCAGGG + Intronic
1102765567 12:115430070-115430092 CCACATTCTCACTCACATCATGG - Intergenic
1103093706 12:118116370-118116392 CCAGTTTCTGAGTCACTTCATGG - Intronic
1106552898 13:30787130-30787152 CCACAGTCTGAGTCCCTGGGTGG - Intergenic
1108266968 13:48720498-48720520 CTACTTTCTGAGTCCCTTCATGG + Intergenic
1108535458 13:51371888-51371910 CCACATTCAGTGTCAATGGAGGG + Intronic
1110355448 13:74561748-74561770 TCACATTCTGAAGTACTGCAAGG - Intergenic
1110382745 13:74873461-74873483 ACACATCCTGAGTCATTGAAAGG + Intergenic
1112765320 13:102735713-102735735 GCATATACTGAGTCACTGCATGG - Exonic
1114744082 14:25128003-25128025 TCACATTCTGAGATACTGGAGGG - Intergenic
1119091836 14:71789963-71789985 CCAGATTCTTAGAGACTGCATGG + Intergenic
1119127486 14:72141179-72141201 CCAGATTCTGGGTCAGTGAATGG - Intronic
1119641206 14:76316250-76316272 CCGCATCGTGAGTCCCTGCATGG - Intronic
1119704356 14:76774669-76774691 CCGCACTCTGAGCCTCTGCAGGG + Intronic
1121172039 14:91862681-91862703 CCTCATTTGGAGTGACTGCAGGG - Intronic
1121875017 14:97443086-97443108 CCACATTCTGAGGTACTGGGAGG + Intergenic
1122808769 14:104277308-104277330 GCACCTTCGCAGTCACTGCAAGG - Intergenic
1125533437 15:40428755-40428777 CCACATTCTGGGGCACTTCCAGG - Intronic
1127695724 15:61444812-61444834 CCCCATTCTGAGTCCATGAAAGG - Intergenic
1128553710 15:68615724-68615746 CCACTTTCTGATTCACTGATGGG - Intronic
1128672104 15:69581385-69581407 GCACCATCTGAGTAACTGCATGG - Intergenic
1130948033 15:88563872-88563894 CTGCATTGTGAGTCACTGCAAGG + Intergenic
1131929954 15:97430828-97430850 CCACATTTTGAGTTACTAAAAGG + Intergenic
1132872916 16:2123633-2123655 CCACGTTCTGGTTCCCTGCAAGG + Intronic
1133935170 16:10263438-10263460 TCACATTCTGGTTGACTGCAGGG - Intergenic
1134552006 16:15142812-15142834 CCACGTTCTGGTTCCCTGCAAGG + Intergenic
1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG + Intronic
1137566821 16:49538483-49538505 CCACATTCAGACACACTGCCTGG + Intronic
1139755776 16:69142469-69142491 CCACCTTCTTAGTCAGGGCATGG + Intronic
1140950055 16:79808457-79808479 CCCCATTCTGAGTCCATGAAAGG + Intergenic
1141321933 16:83019366-83019388 CCACATTTTGTCTCACTGAAAGG + Intronic
1142369789 16:89672502-89672524 CTCCACTCTGAGTCCCTGCATGG - Intergenic
1143970948 17:10795290-10795312 CCTCAATATGAGCCACTGCATGG + Intergenic
1144226556 17:13154862-13154884 GCACATTTTGTGTCACTTCAAGG - Intergenic
1152738279 17:82008039-82008061 CCACATGCTGGGTGGCTGCAGGG + Intronic
1153315913 18:3722152-3722174 CCACATTCGGGGTTATTGCATGG - Intronic
1153632267 18:7082943-7082965 TCCCAATCTGAGTAACTGCAGGG + Intronic
1156063785 18:33115764-33115786 GCACATTCTGAGTCCTTTCAAGG + Intronic
1159273073 18:66178571-66178593 CCACGTTTTGTGTCACTGGAAGG + Intergenic
1162153121 19:8659472-8659494 CACCATTCGGAGTCACCGCAGGG - Intergenic
1162235224 19:9303683-9303705 CCCCATTCTGAGTCTCTCTAGGG + Intronic
1164360862 19:27507747-27507769 ACACTTTCTGAGAAACTGCATGG + Intergenic
1164607224 19:29608667-29608689 CCTCTTTCTGAGACAATGCATGG - Exonic
1164752298 19:30665900-30665922 GCACATTCTGGTGCACTGCATGG + Intronic
1167813906 19:51861614-51861636 TCATATTCCAAGTCACTGCATGG + Intronic
925170216 2:1745440-1745462 CCAGATTCAGAGGCACAGCATGG + Intergenic
925216887 2:2104340-2104362 CTACATTCTGAGTAATAGCATGG + Intronic
926118480 2:10228081-10228103 CCTCGCTCTGAGTCACTGCCTGG + Intergenic
926954270 2:18277041-18277063 CCACAATATGAGTGACTGCAAGG - Intronic
928355311 2:30607775-30607797 CCACATCTTGTCTCACTGCAAGG - Intronic
928619151 2:33071298-33071320 CCACATTCTCATTCACTGTGAGG - Intronic
931511770 2:63004888-63004910 CCACATTCTGATTCAGGACATGG + Intronic
931628148 2:64275588-64275610 CCACAGTGTGAGACATTGCAAGG - Intergenic
934479956 2:94628120-94628142 CCACATGCTATGTCACAGCAAGG + Intergenic
937210415 2:120265648-120265670 CCATACTCTGAGCCACTACATGG - Intronic
940832101 2:158478298-158478320 CAACATTCTAACTCACTGAATGG - Intronic
943326999 2:186511964-186511986 TCACATTCTGAATCACTTAACGG - Intergenic
944343752 2:198635695-198635717 TCACATTCTAAGGCACTGGAGGG - Intergenic
945369779 2:209003062-209003084 CCACATTCTGAGTCCATAAAAGG + Intergenic
948025317 2:234771800-234771822 CCACATTCTGAAGTACTGCGGGG - Intergenic
948444695 2:238023178-238023200 CCCCCTTCTGGGTCACTGGATGG - Intronic
948540374 2:238687004-238687026 CCATATTCAGAGACACAGCAGGG + Intergenic
948770745 2:240250259-240250281 CCACCTCCTGAGACACTGCTGGG + Intergenic
1169260627 20:4135747-4135769 CCATCCTCTGAGTCACTGGAAGG - Intronic
1170551914 20:17485203-17485225 CTGGATCCTGAGTCACTGCATGG - Intergenic
1170577984 20:17679124-17679146 CCACATTCTCATCCACTGAATGG + Intronic
1171807228 20:29690453-29690475 CCTCTTTCTGAGTCTCTGCCTGG + Intergenic
1173097286 20:40047337-40047359 CCATCTTATAAGTCACTGCATGG + Intergenic
1173845942 20:46188880-46188902 CCATCTTCTAAGTCACTGCTTGG - Intronic
1174371821 20:50095166-50095188 CCCCATTCTGAGTCATTTCTAGG + Intronic
1176005130 20:62857537-62857559 CCACATTCTGAATCTCTCCAAGG + Exonic
1178186938 21:30233184-30233206 TCAGGTTCTCAGTCACTGCATGG + Intergenic
1179261968 21:39765409-39765431 ACACAGTCTGAGTCACTGGATGG + Intronic
1182603788 22:31488511-31488533 TCTCATTCTGACTCACTACATGG - Intronic
949891273 3:8735062-8735084 CCAGCATCTGAGTCACTGGAGGG + Intronic
952238843 3:31509055-31509077 TGCCATTCTGAGTAACTGCAGGG + Intergenic
955157535 3:56431461-56431483 CTGGATCCTGAGTCACTGCATGG + Intronic
956458327 3:69445687-69445709 GCACTTGCTGAGTCACTGCTTGG + Intronic
956727057 3:72164783-72164805 CCCCATGCTGTCTCACTGCAGGG - Intergenic
959061837 3:101623237-101623259 CCACATTCTGAGTCCATAAAAGG - Intergenic
961348711 3:126284376-126284398 CCACATTCTGTCCCACTGGAAGG + Intergenic
964049342 3:152372228-152372250 GCACATTCTAACCCACTGCAAGG - Intronic
969095976 4:4733251-4733273 CCACTTTCAGAGCCTCTGCAGGG + Intergenic
969265875 4:6063824-6063846 CCACATCCCGAGTCTCTGAATGG - Intronic
969847648 4:9931872-9931894 CCACATGGAGAGTGACTGCAGGG + Intronic
972092238 4:35301633-35301655 CCACATTGTGGGTCCCTTCAGGG - Intergenic
973707841 4:53597630-53597652 CCACACTCTGAGTCTCTCCAGGG + Intronic
973935352 4:55840866-55840888 TCACATTCTGAGGCATTGGAGGG + Intergenic
974249113 4:59362053-59362075 GCACATTCTAACTCAATGCAAGG - Intergenic
974877377 4:67716017-67716039 CCATATTCTGAGAGACAGCATGG - Intergenic
975447488 4:74483021-74483043 ACACATTTTGAGTCACTTCTAGG - Intergenic
977676345 4:99752188-99752210 CCACATTCTGTCCCACTGGAAGG + Intergenic
982153204 4:152486576-152486598 CCACATACTGTCTCACTGGAAGG + Intronic
982342587 4:154318059-154318081 CCCCATTGTGAGTCCTTGCAGGG - Intronic
982346145 4:154362306-154362328 CCTCTTTCTGAATCACAGCATGG - Intronic
982603396 4:157482120-157482142 CCAGAGTCTGTGGCACTGCATGG - Intergenic
984789426 4:183601626-183601648 CAGCATTCTGTGTCAGTGCATGG - Intergenic
987445781 5:18018039-18018061 ATACATTCTGAGTAACTGAAAGG - Intergenic
987452949 5:18108512-18108534 CCACATTATGAGCCACTGTTTGG - Intergenic
987479786 5:18439195-18439217 CCACATGCTGCATCACAGCATGG - Intergenic
988617587 5:32790364-32790386 CCACATTCAGCATCACTCCAAGG + Exonic
988974518 5:36501746-36501768 CCACATCCTGAGTGACTGCTTGG - Intergenic
990203753 5:53407158-53407180 CCACATTTTGTGCCACTGGAAGG - Intergenic
990990772 5:61681579-61681601 CCACATTCTGGGTTACTGGGTGG - Intronic
991221297 5:64222495-64222517 GCACATTCTGTGTAACTCCATGG - Intronic
991477568 5:67039432-67039454 GAACTCTCTGAGTCACTGCAGGG + Intronic
992391913 5:76337420-76337442 TCACATTCTGAGGCACTGCGGGG + Intronic
993004631 5:82417079-82417101 CCACATTCTGAGGCACTTACGGG + Intergenic
994092838 5:95824027-95824049 CCAGATTCTGAGTCACGGAGGGG + Intronic
995991195 5:118241674-118241696 CATCATTCTGAGTGACTGGAAGG - Intergenic
997436491 5:133879522-133879544 TCACGTTCTGAGTTTCTGCATGG + Intergenic
997596615 5:135111439-135111461 CCACTTTCTGAGTCACAGAGGGG - Intronic
999410651 5:151347026-151347048 CCACATACTGAGTCATTGGCAGG - Intronic
1001959467 5:175871670-175871692 CAACCGTCTGAGCCACTGCAGGG - Intronic
1005134417 6:22551439-22551461 CCACTCACTGAGTCACTGAAAGG + Intergenic
1005728684 6:28674521-28674543 CCTCGTTCTGAGTCTCCGCAAGG + Intergenic
1007449110 6:41929947-41929969 CCACAGACAGAATCACTGCAGGG - Intronic
1010751682 6:79622493-79622515 CAAGATTCTGTGTCTCTGCATGG + Intergenic
1012522403 6:100136784-100136806 CCACAGTCTGGGACACTGGAAGG + Intergenic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1013692899 6:112667217-112667239 CCACAGTTTGAGTAGCTGCAAGG - Intergenic
1015483440 6:133741590-133741612 CCACATTAGGAGTTGCTGCAGGG - Intergenic
1016569535 6:145496983-145497005 GCACATTCTAACTCAATGCAGGG - Intergenic
1016933284 6:149429518-149429540 CCACTTTCTGATTGGCTGCAAGG + Intergenic
1017965280 6:159258877-159258899 CCAGCTTCTGAGTCAATACAGGG + Intronic
1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG + Intergenic
1018737981 6:166703323-166703345 TCACATTAGCAGTCACTGCATGG + Intronic
1019369703 7:655227-655249 GGGCATTCTGGGTCACTGCAAGG - Intronic
1021137684 7:16985913-16985935 CCACTTTGAGAGTCAATGCAGGG - Intergenic
1021689954 7:23222028-23222050 TCACATTTTGCGGCACTGCAGGG - Intergenic
1022554181 7:31275396-31275418 CCACCTTCTGAGCCTGTGCAAGG - Intergenic
1023094054 7:36642089-36642111 TCACATTCTGAGCTTCTGCAGGG - Intronic
1024197449 7:47073101-47073123 CCTCATTGTGGGTCCCTGCATGG - Intergenic
1026948209 7:74329727-74329749 CAACATTGTGGGTCCCTGCAAGG + Intronic
1027844896 7:83360393-83360415 TCACATTCTGAGGCTCTGCTGGG + Intergenic
1028242082 7:88433867-88433889 CCTCATTCTTATTGACTGCAAGG - Intergenic
1029032752 7:97486093-97486115 CAGAATTCTGAGTCAGTGCAGGG + Intergenic
1029629638 7:101742431-101742453 CCACCTTCAAAGTGACTGCAGGG + Intergenic
1034169780 7:149054112-149054134 CCACATACTGGGTCACAGCCTGG + Intergenic
1034362447 7:150512596-150512618 CCACATTCTGGCTCAGTCCAAGG + Intergenic
1034446921 7:151118497-151118519 CTACCTTCTGGGCCACTGCAGGG - Exonic
1037389077 8:18373993-18374015 CTGCAGTCTGAGTCACAGCATGG - Intergenic
1037958108 8:23074435-23074457 CCTCATTCTGGGTCACTGCTGGG + Intergenic
1039795201 8:40906970-40906992 CCAACTTCTGAGGCACTGCTAGG + Intergenic
1039827346 8:41185981-41186003 CCAAATTCTGAGTTACTGGTGGG + Intergenic
1041694105 8:60717461-60717483 TCACATACTGTGCCACTGCAAGG - Intronic
1042462774 8:69090538-69090560 CCACATCCTGTCTCACTGGAAGG + Intergenic
1042733433 8:71962248-71962270 CCACATTCTGAGTCACTGCAGGG - Intronic
1043084484 8:75811277-75811299 CAACATTCTGAGGCAGTGAATGG - Intergenic
1043326949 8:79063906-79063928 TCACTTTCTGAGGCACTCCAGGG + Intergenic
1044006371 8:86941953-86941975 CCCAATTCTGAGCCACTGAAAGG - Intronic
1047629239 8:126688790-126688812 CCTCAGTCTGAGTAACTTCAGGG - Intergenic
1047785618 8:128151607-128151629 CCAGATTCTGACTCCCAGCAGGG - Intergenic
1048638318 8:136324393-136324415 TCACATTCACAGTCACAGCATGG + Intergenic
1049332772 8:142063935-142063957 CCAGATTCGGGGGCACTGCAAGG + Intergenic
1049859785 8:144890483-144890505 CCTCATTCAGAGTCACTGAGGGG + Intronic
1050305559 9:4302086-4302108 TCTCATTCTGAGTCATTCCAGGG - Intronic
1053677886 9:40455681-40455703 CCACATGCTATGTCACAGCAAGG - Intergenic
1053927801 9:43083512-43083534 CCACATGCTATGTCACAGCAAGG - Intergenic
1054285843 9:63169274-63169296 CCACATGCTATGTCACAGCAAGG + Intergenic
1054290959 9:63291207-63291229 CCACATGCTATGTCACAGCAAGG - Intergenic
1054388980 9:64595754-64595776 CCACATGCTATGTCACAGCAAGG - Intergenic
1054506737 9:65920617-65920639 CCACATGCTATGTCACAGCAAGG + Intergenic
1055978047 9:81973490-81973512 CCAAGTTCTGAGTAACTGCCTGG - Intergenic
1056121452 9:83492821-83492843 CAACCTTCAGAGTCACTGTATGG + Intronic
1061302215 9:129711909-129711931 CCACATCCTTAGCCACTGCCTGG - Intronic
1061395778 9:130342675-130342697 CCACATTCTGAGTCACATCCTGG - Intronic
1062445494 9:136592348-136592370 TCACATTCTGAGGCTCTGGAGGG - Intergenic
1186853493 X:13603225-13603247 CCAAATTCTGAGCCATTGAATGG - Intronic
1187888316 X:23909658-23909680 CCAAATTCTTACTCACTGCTTGG - Intronic
1188206424 X:27364444-27364466 CCACAGTCTGAGGTACTGGAAGG + Intergenic
1188835775 X:34952640-34952662 CCATATGCTTATTCACTGCATGG - Intergenic
1189540088 X:41978090-41978112 CCACTTTTTGGTTCACTGCATGG + Intergenic
1192269963 X:69569813-69569835 CCACATGCTGGGTCACTTCTGGG - Intergenic
1194071369 X:89329549-89329571 CCACAATCTGAGTGAGTGCTGGG + Intergenic
1196641021 X:118061021-118061043 CCACATTCTGAGATACTGGTGGG + Intronic
1198370301 X:135983347-135983369 CAACCCTCTCAGTCACTGCATGG - Intergenic
1198533842 X:137568047-137568069 ACACATTCGGAGTCCCTTCACGG - Intronic
1199212866 X:145234373-145234395 CCACTTTGTGAGTGAGTGCAGGG - Intergenic
1199270387 X:145875507-145875529 CCACATGCTGTCTCACTGGAAGG - Intergenic
1200158929 X:153994475-153994497 CCAGATCCTGAGTGACTGTAGGG + Intergenic
1200725600 Y:6665280-6665302 CCACAATCTGAGTGAGTGCTGGG + Intergenic
1201269221 Y:12238281-12238303 GCAGATTCAGAGACACTGCAGGG + Intergenic