ID: 1042733809

View in Genome Browser
Species Human (GRCh38)
Location 8:71965355-71965377
Sequence TGGTGAGTTCTCGTGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5086
Summary {0: 1, 1: 49, 2: 617, 3: 1747, 4: 2672}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042733802_1042733809 4 Left 1042733802 8:71965328-71965350 CCATCCCCCTTGGTGCTGTCCTC 0: 5
1: 28
2: 134
3: 238
4: 563
Right 1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG 0: 1
1: 49
2: 617
3: 1747
4: 2672
1042733803_1042733809 0 Left 1042733803 8:71965332-71965354 CCCCCTTGGTGCTGTCCTCTCGA 0: 1
1: 2
2: 20
3: 107
4: 470
Right 1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG 0: 1
1: 49
2: 617
3: 1747
4: 2672
1042733804_1042733809 -1 Left 1042733804 8:71965333-71965355 CCCCTTGGTGCTGTCCTCTCGAT 0: 2
1: 11
2: 94
3: 437
4: 963
Right 1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG 0: 1
1: 49
2: 617
3: 1747
4: 2672
1042733806_1042733809 -3 Left 1042733806 8:71965335-71965357 CCTTGGTGCTGTCCTCTCGATGG 0: 1
1: 0
2: 15
3: 125
4: 517
Right 1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG 0: 1
1: 49
2: 617
3: 1747
4: 2672
1042733805_1042733809 -2 Left 1042733805 8:71965334-71965356 CCCTTGGTGCTGTCCTCTCGATG 0: 1
1: 0
2: 15
3: 147
4: 559
Right 1042733809 8:71965355-71965377 TGGTGAGTTCTCGTGAGATCTGG 0: 1
1: 49
2: 617
3: 1747
4: 2672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042733809 Original CRISPR TGGTGAGTTCTCGTGAGATC TGG Intronic
Too many off-targets to display for this crispr