ID: 1042736585

View in Genome Browser
Species Human (GRCh38)
Location 8:71996228-71996250
Sequence CAGCTTGACTAGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042736585_1042736593 22 Left 1042736585 8:71996228-71996250 CCATCTTCCTTCTAGTCAAGCTG 0: 1
1: 0
2: 0
3: 31
4: 241
Right 1042736593 8:71996273-71996295 GTGGCCAACAGCCACGTGAAAGG No data
1042736585_1042736588 3 Left 1042736585 8:71996228-71996250 CCATCTTCCTTCTAGTCAAGCTG 0: 1
1: 0
2: 0
3: 31
4: 241
Right 1042736588 8:71996254-71996276 TCCGTGTTTCTCCCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042736585 Original CRISPR CAGCTTGACTAGAAGGAAGA TGG (reversed) Intronic
900080128 1:850409-850431 CAGCTTGACGTGAATGCAGAGGG - Intergenic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
905111135 1:35595403-35595425 CAGCTGGACCAGGAGGGAGAGGG + Intergenic
906149098 1:43577454-43577476 CAGCTGGAGGTGAAGGAAGAGGG - Intronic
911403676 1:97408766-97408788 CAGCATGACTAGAATAAAGCAGG + Intronic
911477101 1:98387116-98387138 TAGCTAGGCTAGAAGGAAAAAGG + Intergenic
912760143 1:112359414-112359436 CAGCATGACTGGGAAGAAGATGG + Intergenic
914265245 1:146032984-146033006 CAGCTGGAGTAAAAGGAAGTGGG + Intergenic
914824592 1:151132203-151132225 CAGCTTGGCTGGAAGGGAGCGGG + Exonic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915186359 1:154108635-154108657 CACCTTCACAAAAAGGAAGAAGG + Intronic
916274068 1:162974888-162974910 CATCTTTACTATAAGGAAGAGGG - Intergenic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
919529585 1:198700561-198700583 CAGCTGGACTAGATGGAATGAGG - Intronic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919667404 1:200305200-200305222 CACCTGGACTAATAGGAAGAGGG + Intergenic
920739322 1:208565220-208565242 AAGTTTGACTAGAAGGAGGGGGG + Intergenic
1063045425 10:2387385-2387407 CTCCTTGGCTACAAGGAAGATGG - Intergenic
1063774680 10:9248738-9248760 CACCTTCACTGAAAGGAAGATGG + Intergenic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1070290875 10:75112258-75112280 AGGTTTGACTAGAAGGAGGAGGG + Intronic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1072688956 10:97557666-97557688 CAGCTAGAACAGAAGAAAGAGGG - Intronic
1074464406 10:113668696-113668718 CAGCTTGGCTAGAACAAAGCAGG - Intergenic
1075301990 10:121333121-121333143 CAGCTTGGCTAGAATTGAGAGGG + Intergenic
1075595373 10:123725363-123725385 CAGCTTGAAGAAAAGCAAGATGG + Intronic
1077912222 11:6582072-6582094 CACCTTCACAAAAAGGAAGATGG + Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1078883406 11:15475917-15475939 CAGCTTGACTAAAATGCAGGGGG - Intergenic
1078928830 11:15897807-15897829 CAGCAAGCCGAGAAGGAAGAGGG - Intergenic
1079678699 11:23264994-23265016 CAGCTTGATTAGGACGAAGCCGG + Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1081123391 11:39292966-39292988 CAGCTTGTCAAGAAGTAAGTGGG - Intergenic
1081690310 11:45073622-45073644 TAGCTGGACCAGAAGGAAGCTGG + Intergenic
1083081291 11:60096259-60096281 CAGATTGACAAGTAGGAAGTGGG + Intronic
1085356239 11:75840302-75840324 AAGCTAGAATAGAAGAAAGAAGG + Intronic
1086966331 11:93031926-93031948 CTGCTGGAGTAGAAGGCAGATGG + Intergenic
1087139159 11:94748854-94748876 CAGCTTGATGGGAAGGAAGTAGG - Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1089943375 11:122442171-122442193 GAGTTTGACTAGTAAGAAGAGGG - Intergenic
1090018812 11:123108857-123108879 CAGCCTGACTAGCATGGAGAAGG + Intronic
1090196956 11:124824797-124824819 CAGCATGACTAGAATAAAGCAGG - Intergenic
1090609650 11:128459310-128459332 CAGCATGACTAGAAGAGAGATGG + Exonic
1090860522 11:130648600-130648622 AATCTTAGCTAGAAGGAAGAAGG + Intergenic
1091653592 12:2327715-2327737 CAGCGTAATTACAAGGAAGATGG + Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092388562 12:8054795-8054817 CACCCTGACTGGAAGGAATAAGG - Exonic
1093556993 12:20488164-20488186 GAGGTTGACTGGGAGGAAGAAGG - Intronic
1097431497 12:59513919-59513941 CATCTTATCAAGAAGGAAGATGG + Intergenic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1099736139 12:86568234-86568256 CAGCTTGATTAGAATAAAGCAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102828155 12:115968438-115968460 CAGGTCGGCTAGAAAGAAGAAGG + Intronic
1102866918 12:116381992-116382014 CAGCTTTATTAAAAAGAAGAAGG - Intergenic
1103742628 12:123101466-123101488 ATGCTTGACTAAAAGGAATAAGG + Intronic
1107508785 13:41061264-41061286 CAGCGAGCCTAGAAGGAGGATGG + Exonic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1108925014 13:55731519-55731541 CAGCATGACTAGAACAAAGCAGG + Intergenic
1110485010 13:76029050-76029072 TGGATTAACTAGAAGGAAGATGG + Intergenic
1112524702 13:100133809-100133831 CAGCGTGGCTAGAATGAAGCAGG + Intronic
1112901277 13:104360758-104360780 CACCTTCACTAAAAGGAAGACGG - Intergenic
1114390770 14:22305772-22305794 CTGCTTGACTCAAAGGATGATGG - Intergenic
1114852238 14:26395086-26395108 CACCTGGACCACAAGGAAGAAGG + Intergenic
1115161402 14:30399654-30399676 CAGCCTGACTAGAATAAAGCAGG - Intergenic
1115296402 14:31832171-31832193 CATCTTGACTACATGGAAGAAGG - Intronic
1115964744 14:38875285-38875307 CAGCTATACTAGAAGGACTAGGG + Intergenic
1116122695 14:40741066-40741088 CAGCTTGGCTAGAACAAAGCAGG - Intergenic
1117758622 14:59002682-59002704 TACCTTGTCTGGAAGGAAGAAGG + Intergenic
1118862710 14:69677167-69677189 CAGCTTGATTTGAAGGCAGGTGG + Intronic
1119855416 14:77896723-77896745 AAGCAAGACTAGAAGGGAGAGGG - Intronic
1120130458 14:80800593-80800615 CCTCTTGTCTAGAAGGAACATGG - Intronic
1120215488 14:81677495-81677517 AGGCTTGACTAAAAGGAGGAGGG + Intergenic
1120780401 14:88481055-88481077 CAAATTGACTAGAAGAAACATGG - Intronic
1123111818 14:105874288-105874310 CACCTTCACTAAAAGGAAGACGG - Intergenic
1123184590 14:106504777-106504799 CAGCATGGCTAGAATGAAGCAGG + Intergenic
1125002939 15:34790375-34790397 CATCCTGACTGGAAGGTAGATGG + Exonic
1126497426 15:49307442-49307464 CAGGTTGATTAGAGGGGAGAGGG + Intronic
1127111179 15:55672510-55672532 AAGCTGTACTACAAGGAAGAAGG - Exonic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127427956 15:58874504-58874526 CAACTTTACTAGTAGGAACAGGG - Intronic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1130966240 15:88699949-88699971 GAGCTGAACTAGAAGGCAGAGGG + Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1133563462 16:6970838-6970860 CAGCATCAATAGAAGAAAGAAGG + Intronic
1133658180 16:7887493-7887515 CAGCTGCACTAAAAGGAAGAGGG + Intergenic
1139048676 16:63096264-63096286 CAGCATGGCTAGAAGAAAGCAGG + Intergenic
1139485306 16:67252885-67252907 GAGCTTGAGGAGAAGGGAGAGGG - Intronic
1139679569 16:68550800-68550822 CAGCTGGATTTGAAGGATGAAGG + Intronic
1141712473 16:85708059-85708081 CAGCCAGACTAGGAGAAAGAGGG + Exonic
1141814240 16:86398779-86398801 CAGCTTCACAAGCAGGAAGAAGG - Intergenic
1142234712 16:88916600-88916622 GAGCTTCTCTGGAAGGAAGAAGG + Intronic
1147401234 17:40181114-40181136 CAGCCTGATTAAAAGGGAGATGG - Intronic
1147796233 17:43045352-43045374 CAGCCTGAATAGAAAGAATAGGG + Intronic
1149075405 17:52591923-52591945 CACCTTCACTAAAAGGAAGATGG - Intergenic
1149669705 17:58395665-58395687 CAGCTTGACAAAAAGAAAGGTGG + Intronic
1153692584 18:7608323-7608345 CAGCTTGTCCAGAACAAAGACGG + Intronic
1153757227 18:8296559-8296581 CAGCTGTTCTAGAAGGATGAAGG - Intronic
1154105941 18:11523186-11523208 CTGCTTGTCTAGAATCAAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158316595 18:56217873-56217895 AAGCTTGATTAGAAAGAAGAAGG - Intergenic
1158468846 18:57716249-57716271 CACCTTCACTAAAAGGCAGAAGG + Intronic
1158524136 18:58197388-58197410 CAGCTTTACAAGAAGGAAACGGG + Intronic
1158545102 18:58389386-58389408 CAGCTAGACTTGAATGAAGTTGG + Intronic
1159720825 18:71888289-71888311 CAGCTTGGCTAGAACAAAGCAGG - Intergenic
1164279958 19:23760362-23760384 AGGCTTTATTAGAAGGAAGAGGG + Intergenic
926448886 2:12978229-12978251 CAGCTTGCTTAGAAGCAGGAAGG - Intergenic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
928119075 2:28568923-28568945 CAGCTTCCCTAGGAGGTAGAAGG - Intronic
931711607 2:64992695-64992717 CATGTTGACTTGGAGGAAGAGGG - Intronic
934025163 2:87996421-87996443 CATCTCGGCTAGAAGGAAGCAGG - Intergenic
934656383 2:96118571-96118593 CAGCATCCCTTGAAGGAAGATGG - Intergenic
935365353 2:102283644-102283666 CAGCTTGTCTGAAAAGAAGATGG - Intergenic
936021903 2:109001493-109001515 GAGCTGGACAAGAAGGGAGAGGG + Intergenic
936157429 2:110057538-110057560 CAGCTTGATTAGAACGAATCCGG + Intergenic
936187263 2:110313906-110313928 CAGCTTGATTAGAACGAATCCGG - Intergenic
937705796 2:124919492-124919514 GAACTTGACGAGGAGGAAGAGGG + Intergenic
941520605 2:166537360-166537382 CAGCATGACTAGAACAAAGCAGG - Intergenic
941717830 2:168782278-168782300 CAGCATGAGTTGAATGAAGAAGG + Intergenic
942683171 2:178500835-178500857 GAGCTGAACTAAAAGGAAGAGGG - Intronic
942740700 2:179174274-179174296 CTGTTTGACTAGAAGTAAAAAGG + Intronic
942750452 2:179280519-179280541 CACCTTCACTAAAAGGAAGACGG + Intergenic
943331403 2:186563762-186563784 CACCTTCACCAAAAGGAAGATGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
946827544 2:223694508-223694530 CAGCTGGGGTAGCAGGAAGAAGG - Intergenic
947025132 2:225729464-225729486 CTGCCTGACAAGAAGCAAGAGGG + Intergenic
947314982 2:228847145-228847167 CAGCTTGGCTAGAATAAAGCAGG + Intergenic
947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG + Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
1168899722 20:1352762-1352784 CACCTTCATTAAAAGGAAGATGG - Intronic
1169688296 20:8301621-8301643 CAGCATGACCAGAAGGACAATGG - Intronic
1170912732 20:20590885-20590907 TGGCTGGAGTAGAAGGAAGACGG - Intronic
1172109167 20:32535575-32535597 CAGCGTGATTTGAAAGAAGATGG - Intronic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1174714559 20:52743928-52743950 CAGCATGACTAGAAGACAGAGGG - Intergenic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1175621315 20:60449953-60449975 CAGCTTGACTAGACATTAGAGGG + Intergenic
1176693102 21:9942156-9942178 CAGCTTGGCTAGAACAAAGCTGG + Intergenic
1177105397 21:16948635-16948657 CATCTTAAATAAAAGGAAGATGG + Intergenic
1177521038 21:22226300-22226322 CAGGTTGAATAGAAGTAAGGAGG - Intergenic
1177970332 21:27780755-27780777 CACCTTCACTAAAAGGAAGATGG + Intergenic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1179405127 21:41119433-41119455 CAGCTTCATTAGAAAGAAGAAGG - Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
951398916 3:22205805-22205827 CACCTTCACTAAAAGGAAGAAGG + Intronic
951423354 3:22513297-22513319 CACCTTCACTAAAAGAAAGATGG + Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952213642 3:31254125-31254147 CATCTTGACTGGAGGGAAAAGGG - Intergenic
952635793 3:35529211-35529233 CCCTTTGACTAGAAGCAAGATGG - Intergenic
955423832 3:58766923-58766945 GAGCTCGACTAGATTGAAGAGGG - Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
957275382 3:78084390-78084412 CATCATGAATAGGAGGAAGATGG + Intergenic
959381787 3:105649753-105649775 CATCTTTACTTGAAGAAAGAAGG - Intergenic
960157069 3:114306953-114306975 GAGTTGGACTAGAAGTAAGAGGG + Intronic
961733400 3:128984365-128984387 CAGCATGGCTAGAAGAAAGCAGG + Intronic
969451263 4:7274828-7274850 CAGGCTGACTTGAAGGGAGATGG + Intronic
970600096 4:17635163-17635185 GGGTTTGACTTGAAGGAAGATGG + Intronic
971348178 4:25831013-25831035 CAGATAGAATAGAAAGAAGAAGG + Intronic
972666975 4:41174711-41174733 GAGCTTGACTAGTAGGTAGCTGG - Intronic
972919333 4:43918998-43919020 AAGCTTCACTAGAAGACAGATGG - Intergenic
973022460 4:45220461-45220483 CAGCTTGACTTCAGTGAAGATGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973681337 4:53323683-53323705 CAGGTTGACTATAATGAAAAAGG - Intronic
973706885 4:53589785-53589807 CAGATTGACTAGAATGCAGTTGG - Intronic
973755974 4:54073755-54073777 CAGCAAGGCTAGAAGAAAGAGGG + Intronic
974301229 4:60069704-60069726 CACCTTCACTAAAAGTAAGATGG + Intergenic
974474828 4:62365343-62365365 AACCTTGGCCAGAAGGAAGATGG + Intergenic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
975720536 4:77244707-77244729 CAGCATGGCTAGAAGAAAGCAGG - Intronic
977325418 4:95569538-95569560 CACCTTCACTAATAGGAAGATGG - Intergenic
978655759 4:111063766-111063788 CAGCTTGCCTGGAATGAAGAAGG + Intergenic
980340075 4:131533129-131533151 CAGATTGACTAATAGGAGGAAGG + Intergenic
980365709 4:131802374-131802396 CAGCTTGGCTAGAACAAAGCTGG + Intergenic
983875900 4:172874334-172874356 CAGATAGACTAGAATTAAGATGG + Intronic
986657349 5:10028320-10028342 CACCTTCACTAAAAGGAAGATGG - Intergenic
986677262 5:10196984-10197006 CAGCATGACTAGAACAAAGTAGG + Intergenic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
988050014 5:26015621-26015643 CAGCTTGGCTAGAATAAAGCAGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
993183436 5:84585271-84585293 CAGATTTTCTAGAAGGTAGAGGG + Intergenic
993509271 5:88751499-88751521 TAGCTTGGCCAGGAGGAAGAGGG + Intronic
994154603 5:96488969-96488991 CAACTTGGCTTTAAGGAAGAGGG + Intergenic
994255545 5:97590057-97590079 CATCTTGACTAAAAAGAACAAGG - Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995861437 5:116644868-116644890 CAGCGTGACTAGAACAAAGCAGG - Intergenic
995950129 5:117701911-117701933 CAACTTGACTACATGGAAGAGGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998760485 5:145426798-145426820 CACCTTGAATAGAAAGAATATGG + Intergenic
999942363 5:156557755-156557777 CAGCTTGATGAGGAGGCAGAGGG - Intronic
1000231849 5:159323089-159323111 CTGCTTCACAAAAAGGAAGATGG - Exonic
1000444366 5:161301739-161301761 AAGCTGGACTAGAAAGCAGATGG - Intronic
1001754101 5:174153505-174153527 CAGATTGACTACAAGAAGGATGG - Intronic
1003213285 6:4087207-4087229 GAGCTTTGCTAAAAGGAAGAGGG - Intronic
1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG + Intronic
1005434382 6:25792663-25792685 AAGCTTGACAAGGAGGAGGATGG - Intronic
1005776997 6:29144566-29144588 AAGCTACACTAGAATGAAGATGG - Intergenic
1008582744 6:52921360-52921382 CAGCTTGATTAGGATGAAGCCGG + Intergenic
1011830173 6:91362826-91362848 CAGCATGGCTAGAATGAAGCAGG + Intergenic
1014048627 6:116925574-116925596 CAGGTTGACTGGATGGCAGAGGG - Exonic
1015885346 6:137911953-137911975 CTGCTTGGCTTGAAGGGAGAAGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016398560 6:143653235-143653257 CAGCTTGACTAAAATCCAGAGGG - Intronic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1020937593 7:14486593-14486615 CAACTCCACTAGAAGAAAGAGGG + Intronic
1021147394 7:17106127-17106149 CAACTTGGCTAGAAGAAAGCAGG - Intergenic
1022541753 7:31143727-31143749 CACCTTCACTAAAAGTAAGATGG - Intergenic
1022875713 7:34526805-34526827 CACCTTCACTAAAAGGAAGATGG - Intergenic
1024602997 7:51001603-51001625 CAACTTGACTGGATTGAAGAAGG - Intergenic
1025807722 7:64850890-64850912 CAGACTGACTAGAAGAAACATGG - Intergenic
1026455229 7:70566251-70566273 CTGCTTGACTAGGAGACAGAAGG - Intronic
1028295448 7:89124103-89124125 CAGCTTGACCAGAAGCCAGAGGG - Intronic
1030486095 7:110169818-110169840 CAGTTTGATTAGAACCAAGAGGG - Intergenic
1031490406 7:122380907-122380929 TAGCTTGAAGAGAAGGAAAACGG + Intronic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032535105 7:132656640-132656662 CAGCCTGGCTAGAAGAAAGCAGG + Intronic
1032849917 7:135785231-135785253 TAGCTTAGCTAGAAGGAAGGAGG + Intergenic
1033061174 7:138109599-138109621 CAGCTCCACTAGAAGGGGGAAGG + Intronic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1037185639 8:16059078-16059100 CAGCATGACTAGCCTGAAGAGGG + Intergenic
1037217902 8:16480113-16480135 CAGCTTGACATGAAGGGAGATGG - Intronic
1037469349 8:19192016-19192038 CATCCTGACTAGAAGCCAGAAGG + Intergenic
1039097512 8:33902374-33902396 GAGCTCAACTAGAAGCAAGATGG - Intergenic
1039432455 8:37535581-37535603 GAGCTCGTCTTGAAGGAAGAAGG - Intergenic
1039913339 8:41842057-41842079 CACCTTGGCTGGAAGCAAGAAGG + Intronic
1041706307 8:60849922-60849944 CAAGTTGACTAGATGGAAAATGG - Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1043731083 8:83682975-83682997 CAATTTGACTAGCAGGAAGATGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1046717568 8:117584316-117584338 CTGGTTCCCTAGAAGGAAGAAGG + Intergenic
1047080501 8:121454469-121454491 CAGCTTGCCTAGAAGGTAAGTGG - Intergenic
1047808659 8:128384050-128384072 CAGCTTGTCTGGGATGAAGAAGG + Intergenic
1049001017 8:139825734-139825756 CAGCTTGCCCGGAAGGAAAAAGG + Intronic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1050933441 9:11361243-11361265 CAGCATGGCTAGAATAAAGAAGG + Intergenic
1051103432 9:13549354-13549376 CAGATTAACTTGAAGGTAGAAGG + Intergenic
1051436143 9:17034516-17034538 CAGCTTAACCAGAATAAAGATGG - Intergenic
1053630057 9:39928244-39928266 CAGCTTGGCTAGAACAAAGCTGG + Intergenic
1053775715 9:41535288-41535310 CAGCTTGGCTAGAACAAAGCTGG - Intergenic
1054213830 9:62322458-62322480 CAGCTTGGCTAGAACAAAGCTGG - Intergenic
1054982853 9:71226234-71226256 CACCTTCATTAAAAGGAAGATGG + Intronic
1055480141 9:76701630-76701652 TAGCTTGACAGGAAGAAAGAAGG + Intronic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1057534556 9:95886856-95886878 CAGCGTGGCTAGAAGTAAGCAGG + Intronic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059380135 9:113916986-113917008 CATCTTGTTCAGAAGGAAGAGGG + Intronic
1060059543 9:120446771-120446793 CATCTTGGGAAGAAGGAAGAAGG - Intronic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1187216201 X:17279320-17279342 GATCTTGAGTAGAAGGAAGGAGG + Intergenic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1189785714 X:44557192-44557214 CAGCATGACTAGAACAAAGCAGG - Intergenic
1190412909 X:50154617-50154639 CAGCTTGTTTAGAAGCAGGATGG + Intergenic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1191795372 X:65016219-65016241 CACCCTGACTTGAAGGAAGCTGG - Intronic
1193852289 X:86553344-86553366 CAGCATGGCTAGAATAAAGAAGG - Intronic
1194064692 X:89247269-89247291 CAGCATGACTAGAAAAAAGCGGG + Intergenic
1194421019 X:93673067-93673089 CCGCTTGTATAGAAAGAAGAGGG - Exonic
1195807457 X:108791643-108791665 GATCTTCACTAAAAGGAAGATGG - Intergenic
1197347832 X:125345821-125345843 CAGCATAACTAAAAGGGAGATGG - Intergenic
1199024770 X:142923422-142923444 CAGCATGACAAGAAGGATGAAGG - Intergenic
1199316476 X:146384632-146384654 CAGCTTTTCTGGAAGGATGAGGG - Intergenic
1199488238 X:148371301-148371323 CACCCAGACTAAAAGGAAGAGGG + Intergenic
1199843058 X:151670388-151670410 TAGCTGGAATAGAAGGAATAAGG - Intronic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic
1200546731 Y:4527228-4527250 CAGCTTGATTAGAATGAACCCGG + Intergenic
1201185542 Y:11398789-11398811 CAGATTTACTAGAACTAAGAGGG + Intergenic