ID: 1042738048

View in Genome Browser
Species Human (GRCh38)
Location 8:72010952-72010974
Sequence CTAGCTTGCCAGCACACCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042738044_1042738048 30 Left 1042738044 8:72010899-72010921 CCATGGTGAGAATATTTACACTA 0: 1
1: 7
2: 76
3: 281
4: 672
Right 1042738048 8:72010952-72010974 CTAGCTTGCCAGCACACCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042738048 Original CRISPR CTAGCTTGCCAGCACACCGT TGG Intronic
No off target data available for this crispr