ID: 1042740959

View in Genome Browser
Species Human (GRCh38)
Location 8:72045925-72045947
Sequence GAATGAACCCCATTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042740959_1042740964 27 Left 1042740959 8:72045925-72045947 CCTGCTTCCAATGGGGTTCATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1042740964 8:72045975-72045997 TGAATGGTCAGAGTTTACCTTGG No data
1042740959_1042740962 11 Left 1042740959 8:72045925-72045947 CCTGCTTCCAATGGGGTTCATTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1042740962 8:72045959-72045981 AAGATCTAAGAACCTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042740959 Original CRISPR GAATGAACCCCATTGGAAGC AGG (reversed) Intronic
903437283 1:23360165-23360187 GAAGGAACCCCCCTGGAAGATGG + Exonic
905932426 1:41798844-41798866 GAAGGAGCCCCATCAGAAGCAGG - Intronic
915428093 1:155843782-155843804 CAATCACCCCCATTGGAACCTGG + Intronic
923738062 1:236630645-236630667 GAAGAAACTCCATGGGAAGCTGG + Intergenic
1063390467 10:5646916-5646938 GAAGTATCTCCATTGGAAGCAGG - Intronic
1064723119 10:18249980-18250002 GAATGAGTCCAGTTGGAAGCTGG - Intronic
1070793815 10:79205318-79205340 GAATGAGCCCCAGTGGGAGGTGG - Intronic
1076264043 10:129094988-129095010 GAATGAGTCCTATTGAAAGCTGG - Intergenic
1079620057 11:22543065-22543087 GAATAAACCACATTGCAAGATGG + Intergenic
1082941359 11:58708670-58708692 TAATGCACCACCTTGGAAGCAGG + Intronic
1085482989 11:76838074-76838096 AAATGAACCCCATTGTATACAGG + Intergenic
1088151073 11:106746103-106746125 GAATGAAAGCCACTGGAATCTGG + Intronic
1091229553 11:133979118-133979140 GAGTGAACCTCCTTGGAAGCAGG + Intergenic
1092154960 12:6276133-6276155 GAATGAACGCCACTGGGAGGGGG + Intergenic
1095232653 12:39759930-39759952 GAAAGAACCAGATTAGAAGCAGG + Exonic
1100881722 12:99025808-99025830 GAAGGAAATCCACTGGAAGCTGG + Intronic
1101874230 12:108588280-108588302 GAATGAATCCCTTGGGAAGGGGG - Intergenic
1104139265 12:125972070-125972092 GAAGGAACCACCTGGGAAGCTGG - Intergenic
1106409878 13:29504227-29504249 GAGTGAACCACATGGAAAGCTGG - Exonic
1107084847 13:36415744-36415766 AAAATAACCCCATTGAAAGCTGG + Intergenic
1107709879 13:43141223-43141245 GAGGGAACCCAAATGGAAGCAGG + Intergenic
1109332228 13:60944001-60944023 GAATCTTCTCCATTGGAAGCAGG - Intergenic
1109728274 13:66374439-66374461 GATTGCAGCCCATAGGAAGCCGG + Intronic
1118961989 14:70542397-70542419 TAATAAACCCCTTTGGAAACTGG + Intergenic
1121338348 14:93090584-93090606 GAATGAGCCCCATTTGCAGGGGG + Intronic
1121924773 14:97917525-97917547 GAAAGAAGCCCAGTGGAAACTGG + Intergenic
1125306727 15:38325735-38325757 TAGTGAACCACCTTGGAAGCAGG + Intronic
1128636990 15:69308988-69309010 GAATGAAACCAACTAGAAGCTGG + Intronic
1133295261 16:4748840-4748862 GGGTGAACCCCAGGGGAAGCTGG - Exonic
1135145816 16:19961914-19961936 GAAGGCACCACATTGGAAGGGGG - Intergenic
1137462973 16:48682605-48682627 GGATGAAACCCAGAGGAAGCAGG - Intergenic
1142522367 17:514219-514241 GAAGGAACCCCATTTCCAGCAGG + Exonic
1142522377 17:514265-514287 GAAGGAACCCCATTTCCAGCAGG + Exonic
1142522387 17:514311-514333 GAAGGAACCCCATTTCCAGCAGG + Exonic
1142522426 17:514541-514563 GAAGGAACCCCATTTCCAGCAGG + Exonic
1147570746 17:41569283-41569305 GAATGACTTCCATTGGAAGATGG + Intronic
1149056630 17:52374844-52374866 GAATGAACACAAAAGGAAGCGGG - Intergenic
1151465993 17:74285473-74285495 GAATGATCCCTATTGGCTGCTGG - Intronic
1151555791 17:74846102-74846124 GAAGGACTCCCACTGGAAGCGGG - Exonic
1152319727 17:79601720-79601742 GAAAGAACCCCATGGGAAGGGGG + Intergenic
1162408392 19:10489652-10489674 CAATGAACACCATCCGAAGCGGG - Exonic
1163002779 19:14379180-14379202 GAATGAACACCAGCAGAAGCTGG - Intergenic
1165069934 19:33249265-33249287 GATGGAACCGCATTGGGAGCTGG + Intergenic
1166813210 19:45526451-45526473 CAATGAACCCCACAGGAAGGGGG + Exonic
1167106123 19:47430680-47430702 GAATGAATCCCACAGAAAGCAGG - Intronic
925627278 2:5853811-5853833 GGAGGAACCACTTTGGAAGCAGG + Intergenic
938702634 2:133893114-133893136 AGATGAACCCCTTTGGATGCTGG - Intergenic
941185843 2:162320393-162320415 GAATAAAACCCACTGGCAGCTGG - Intronic
942574440 2:177348655-177348677 TAATGAACCCCATTGTGTGCTGG + Intronic
943727209 2:191264859-191264881 GAATCAACAGCGTTGGAAGCTGG + Intronic
946346893 2:219118259-219118281 GAATGAAATCCATTGGGTGCTGG - Intronic
948717556 2:239875028-239875050 GGATGATCCCCAGTGGAGGCAGG + Intergenic
1169836269 20:9883164-9883186 GAATGAATCCCATTTGAATATGG + Intergenic
1170331257 20:15213397-15213419 TAATGAACTCCATTAGAAGGAGG + Intronic
1182772256 22:32803954-32803976 GGAAGGCCCCCATTGGAAGCAGG - Intronic
949646240 3:6098184-6098206 AAATTAAACCCAATGGAAGCTGG + Intergenic
950749737 3:15119178-15119200 AAATTAACCCCATTCGAGGCAGG + Intergenic
951639048 3:24813812-24813834 GAATGAACCTCATTGGAACTGGG + Intergenic
952501180 3:33963563-33963585 GAGTGAGCCACCTTGGAAGCAGG - Intergenic
956731675 3:72202085-72202107 TAAAAAAACCCATTGGAAGCTGG - Intergenic
957251176 3:77772820-77772842 GTATGAATACCATTGGGAGCTGG - Intergenic
959793224 3:110389944-110389966 AAATGAAGCCTATTGGAAGGTGG + Intergenic
960881913 3:122353978-122354000 GGAAGAACACCAGTGGAAGCTGG - Intergenic
961505514 3:127368530-127368552 GAAAGAACCCCTATGGGAGCAGG + Intergenic
963717510 3:148820992-148821014 TTCTGAACCCCATTGGAAGGTGG - Intronic
972146190 4:36029418-36029440 AAATGAAACCAATTGGAAACAGG - Intronic
975436931 4:74364604-74364626 GCCTGAGCCACATTGGAAGCAGG + Intergenic
976061553 4:81134458-81134480 GAAGGAACCCCATTAGAATGGGG - Intronic
980098029 4:128513073-128513095 GAATGACACCCAGTGGGAGCTGG - Intergenic
981769516 4:148291757-148291779 GAAATAACCCCATTGTAAGAAGG - Intronic
982347253 4:154373697-154373719 GAGGGAACCCTCTTGGAAGCAGG - Intronic
984334867 4:178378032-178378054 GGATGAACACCCTTGGAACCTGG - Intergenic
987693672 5:21300784-21300806 CAATGATCACCATTGGAAACTGG + Intergenic
988730586 5:33968892-33968914 TCATGAACCCCATGGGAAGATGG - Intronic
990943632 5:61228623-61228645 GAAGTAACCCCATAGGAAGGTGG + Intergenic
991746592 5:69748756-69748778 CAATGATCACCATTGGAAACCGG - Intergenic
991751113 5:69806486-69806508 CAATGATCACCATTGGAAACCGG + Intergenic
991798192 5:70328699-70328721 CAATGATCACCATTGGAAACCGG - Intergenic
991825970 5:70624068-70624090 CAATGATCACCATTGGAAACCGG - Intergenic
991830402 5:70681381-70681403 CAATGATCACCATTGGAAACCGG + Intergenic
995684438 5:114757018-114757040 GAATGAGCCACATTGGAAGTAGG - Intergenic
998606973 5:143645538-143645560 GAATGAAGCCTTTTTGAAGCAGG + Intergenic
1000151590 5:158507116-158507138 AAATGAACCCAGGTGGAAGCAGG + Intergenic
1000576468 5:162981298-162981320 GCATGAACCTCATTGCAAGAGGG + Intergenic
1002446382 5:179292743-179292765 GAGAGAAGCCCATTGTAAGCAGG + Intronic
1005557238 6:26999152-26999174 CAATGATCACCATTGGAAACCGG - Intergenic
1007094090 6:39202733-39202755 CAATCAATCCCATTGGCAGCAGG + Intronic
1008232363 6:48997806-48997828 AAATCAACCCAATTGGAAGTTGG - Intergenic
1009183128 6:60542788-60542810 GAATGAACCCTATTGGTGGACGG - Intergenic
1014519052 6:122416224-122416246 GAATGAGTCCCTTTGGAAGGAGG + Exonic
1022568705 7:31429905-31429927 GAATGAAGCCCAGTGTCAGCAGG + Intergenic
1023612315 7:41983471-41983493 GAATTGACCCCATATGAAGCTGG + Intronic
1024096494 7:45986863-45986885 GAAAGAAGCCCATGGGAAGTTGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1027348228 7:77284024-77284046 AAATGAACCTTGTTGGAAGCAGG - Intronic
1028784672 7:94778390-94778412 GCATGAACTCCACTGGAACCTGG - Intergenic
1028966076 7:96802842-96802864 AAATGAACTCATTTGGAAGCAGG + Intergenic
1034659360 7:152756132-152756154 GAATAAACACCATTCGATGCTGG + Intergenic
1035963391 8:4162766-4162788 GAGTGAACCCTATTGTAAACTGG - Intronic
1041317465 8:56579418-56579440 GAGTGAAGCCCTTTGGAGGCAGG - Intergenic
1041571927 8:59346942-59346964 GCAGGAACCACATTGGGAGCAGG + Intergenic
1042740959 8:72045925-72045947 GAATGAACCCCATTGGAAGCAGG - Intronic
1045768164 8:105702081-105702103 TAATGAACCACATTGTAAGATGG - Intronic
1047603435 8:126450449-126450471 GAAAGAACCCAGTTGGTAGCTGG - Intergenic
1048918706 8:139208215-139208237 GAATGCACATCATTGGCAGCAGG + Intergenic
1050078238 9:1887783-1887805 GAATGAGCCCTCTTGGAAGTGGG - Intergenic
1050376950 9:4984342-4984364 GAATGAGGCCCTTTGGCAGCCGG + Intergenic
1051384303 9:16490771-16490793 AAATGAACCCCTTTGAAAGTTGG - Intronic
1055845675 9:80559469-80559491 GAATAAGCCACATTGGAAGTAGG + Intergenic
1061335360 9:129930386-129930408 GCATGAACCCCATTGAGAACTGG - Intronic
1194263975 X:91733440-91733462 GAATGGACCCCCTGGGAAGATGG - Intergenic
1197642578 X:128983346-128983368 CAATGAACCCCATTAAAAACTGG + Intergenic
1199616673 X:149661332-149661354 GAAGTAACCCCATACGAAGCAGG + Intergenic
1199625968 X:149741916-149741938 GAAGTAACCCCATACGAAGCAGG - Intergenic