ID: 1042740959

View in Genome Browser
Species Human (GRCh38)
Location 8:72045925-72045947
Sequence GAATGAACCCCATTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042740959_1042740962 11 Left 1042740959 8:72045925-72045947 CCTGCTTCCAATGGGGTTCATTC No data
Right 1042740962 8:72045959-72045981 AAGATCTAAGAACCTCTGAATGG No data
1042740959_1042740964 27 Left 1042740959 8:72045925-72045947 CCTGCTTCCAATGGGGTTCATTC No data
Right 1042740964 8:72045975-72045997 TGAATGGTCAGAGTTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042740959 Original CRISPR GAATGAACCCCATTGGAAGC AGG (reversed) Intronic