ID: 1042740962 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:72045959-72045981 |
| Sequence | AAGATCTAAGAACCTCTGAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042740959_1042740962 | 11 | Left | 1042740959 | 8:72045925-72045947 | CCTGCTTCCAATGGGGTTCATTC | No data | ||
| Right | 1042740962 | 8:72045959-72045981 | AAGATCTAAGAACCTCTGAATGG | No data | ||||
| 1042740961_1042740962 | 4 | Left | 1042740961 | 8:72045932-72045954 | CCAATGGGGTTCATTCATCTGGA | No data | ||
| Right | 1042740962 | 8:72045959-72045981 | AAGATCTAAGAACCTCTGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042740962 | Original CRISPR | AAGATCTAAGAACCTCTGAA TGG | Intronic | ||