ID: 1042740964 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:72045975-72045997 |
Sequence | TGAATGGTCAGAGTTTACCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042740959_1042740964 | 27 | Left | 1042740959 | 8:72045925-72045947 | CCTGCTTCCAATGGGGTTCATTC | No data | ||
Right | 1042740964 | 8:72045975-72045997 | TGAATGGTCAGAGTTTACCTTGG | No data | ||||
1042740961_1042740964 | 20 | Left | 1042740961 | 8:72045932-72045954 | CCAATGGGGTTCATTCATCTGGA | No data | ||
Right | 1042740964 | 8:72045975-72045997 | TGAATGGTCAGAGTTTACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042740964 | Original CRISPR | TGAATGGTCAGAGTTTACCT TGG | Intronic | ||