ID: 1042741150

View in Genome Browser
Species Human (GRCh38)
Location 8:72048346-72048368
Sequence CTGTAGAACTTGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042741133_1042741150 29 Left 1042741133 8:72048294-72048316 CCCCATATGGCCCCATCAATGCA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741135_1042741150 27 Left 1042741135 8:72048296-72048318 CCATATGGCCCCATCAATGCATC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741144_1042741150 -1 Left 1042741144 8:72048324-72048346 CCTCCTGGGGCATCTGGTGAACC 0: 1
1: 0
2: 6
3: 11
4: 192
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741138_1042741150 18 Left 1042741138 8:72048305-72048327 CCCATCAATGCATCTAGGACCTC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741137_1042741150 19 Left 1042741137 8:72048304-72048326 CCCCATCAATGCATCTAGGACCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741139_1042741150 17 Left 1042741139 8:72048306-72048328 CCATCAATGCATCTAGGACCTCC 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741145_1042741150 -4 Left 1042741145 8:72048327-72048349 CCTGGGGCATCTGGTGAACCTGT 0: 1
1: 0
2: 4
3: 14
4: 163
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data
1042741134_1042741150 28 Left 1042741134 8:72048295-72048317 CCCATATGGCCCCATCAATGCAT 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042741150 Original CRISPR CTGTAGAACTTGAGGGTAGA GGG Intronic
No off target data available for this crispr