ID: 1042741241

View in Genome Browser
Species Human (GRCh38)
Location 8:72049561-72049583
Sequence ATAAGCAATCTGGGAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042741241 Original CRISPR ATAAGCAATCTGGGAAAGTT GGG (reversed) Intronic
907771560 1:57470245-57470267 ATAAGCAATCTTGGCAGTTTGGG + Intronic
908265895 1:62378844-62378866 AGAAGCAATCTTCAAAAGTTAGG + Intergenic
908280645 1:62531120-62531142 ATGAGGAATCTGGGGAAGGTGGG - Intronic
910033806 1:82765885-82765907 CTAAGCAATCTGGGAACAGTGGG + Intergenic
911718000 1:101157294-101157316 ATAAGAAAGATGGGAAAGGTTGG + Intergenic
912267499 1:108173657-108173679 AGAAGAAGACTGGGAAAGTTTGG + Intronic
912271362 1:108212530-108212552 AAATGAAAGCTGGGAAAGTTTGG - Intergenic
916333041 1:163639733-163639755 ACAATCAATTTGGAAAAGTTTGG - Intergenic
917648367 1:177050560-177050582 ATAATAAATCTAGGAAAGTCAGG - Intronic
918810431 1:189111483-189111505 AAAATCAATCTGAGAAAGTTGGG - Intergenic
918886529 1:190201085-190201107 AGAAAAAATGTGGGAAAGTTTGG + Intronic
919072251 1:192771175-192771197 ACAAGCACTTTGGAAAAGTTTGG + Intergenic
919261995 1:195208374-195208396 ATAAGCAAACTGCCAAAGCTTGG - Intergenic
919305237 1:195824110-195824132 ATAAACAACCTGGAAAACTTTGG + Intergenic
919371104 1:196727066-196727088 ATAAGCAATATGCAAAAGATTGG - Intronic
919676785 1:200391881-200391903 ATTTGCATACTGGGAAAGTTGGG - Intergenic
920694241 1:208169725-208169747 ATAACCAATCTGAGAAAGCCAGG + Intronic
922891718 1:229066856-229066878 ATAAGCACCCTGGGAAGGATGGG + Intergenic
923749213 1:236731791-236731813 AAAAACAATATGTGAAAGTTTGG - Intronic
924001613 1:239559558-239559580 ATAAGATTTCAGGGAAAGTTAGG + Intronic
924870181 1:248033933-248033955 ATAAGCAAAGAGGGACAGTTTGG - Intronic
1064361570 10:14670276-14670298 ATAAGCAATTTGGGTAAATAAGG + Intronic
1065734945 10:28743215-28743237 ATAAGCCTTCTGGGGAGGTTTGG + Intergenic
1066036095 10:31486304-31486326 ACAACCACTCTGGAAAAGTTTGG - Intronic
1067975122 10:51016001-51016023 ATTAGCAATGAGGGAAAGTCAGG + Intronic
1068669896 10:59711805-59711827 AAAAGAAATCTGGGAAAACTTGG - Intronic
1069666050 10:70159747-70159769 ATAAATATTCTGGGAAAGTAGGG - Intronic
1070400655 10:76050742-76050764 CAAATCAATATGGGAAAGTTGGG + Intronic
1071139412 10:82490271-82490293 AAAAGCAATCTGAAAAAGTTAGG - Intronic
1071139835 10:82495558-82495580 CAGAGTAATCTGGGAAAGTTGGG + Intronic
1071515332 10:86293179-86293201 ATAACAAAGCTGGGAAAGGTTGG - Intronic
1075773835 10:124965786-124965808 CTAAGCAGTCTGGTAAAGTATGG - Intronic
1078124790 11:8550803-8550825 ACAGGAAATGTGGGAAAGTTTGG - Intronic
1078551651 11:12285310-12285332 AGATGCAATTTGGGAAGGTTCGG + Intronic
1079873681 11:25831245-25831267 ATCAGAAAAATGGGAAAGTTTGG - Intergenic
1082622980 11:55446721-55446743 ATAAGCAATGTGGAAAAGTGTGG - Intergenic
1084627829 11:70322375-70322397 ATAAGAAATCTCTGAAACTTAGG + Intronic
1085829603 11:79885309-79885331 ATAGGCAATTTGGGCAATTTGGG + Intergenic
1086309647 11:85521609-85521631 AAAAAAAATGTGGGAAAGTTTGG + Intronic
1086922766 11:92606015-92606037 ATTTGCAAGCTGGGCAAGTTAGG + Intronic
1087914399 11:103792873-103792895 ACAAGCACTCTGGAAGAGTTTGG + Intergenic
1090158094 11:124463133-124463155 ATAAGTCTTCTGGAAAAGTTAGG - Intergenic
1090505969 11:127314553-127314575 ATAACCACTCTGGAAAAATTTGG - Intergenic
1090751887 11:129753729-129753751 ATAGCCAGTCTGGAAAAGTTTGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092735872 12:11582312-11582334 ATTAGCTTTCAGGGAAAGTTTGG - Intergenic
1093799873 12:23360569-23360591 ACAAGCAATTTGAAAAAGTTGGG - Intergenic
1095373747 12:41501556-41501578 ATAAGCAACTTGCGAATGTTAGG - Intronic
1095603399 12:44039225-44039247 ATAAGAAATCTGTGAAAGAATGG - Intronic
1097569148 12:61309361-61309383 ATAAGAAATCAGGAAAAATTTGG - Intergenic
1098944505 12:76574582-76574604 ACAGGAAATATGGGAAAGTTTGG - Intergenic
1099546271 12:83984127-83984149 AAAAGAAACCTGGGAAACTTGGG + Intergenic
1100354156 12:93813421-93813443 TCAAGTAATCAGGGAAAGTTGGG + Intronic
1104529799 12:129558632-129558654 AAAGGGAATCTGGGAAAGTCAGG + Intronic
1107844141 13:44493649-44493671 ATCAGCAAGATGTGAAAGTTTGG - Intronic
1108670107 13:52678056-52678078 ATAAGCAAGCTGGGTCAGATAGG - Intronic
1108846760 13:54687288-54687310 CTATGGAATCTGGGGAAGTTTGG + Intergenic
1110934552 13:81270812-81270834 ATAAGAAATATGGGAGAGCTGGG - Intergenic
1111593621 13:90382400-90382422 ATATGCAATATGGGAATGCTTGG + Intergenic
1111738853 13:92176658-92176680 ATTAGGAATCTGGGGAAGGTTGG - Intronic
1112990434 13:105506789-105506811 ATAAGAAATCTGGGAAACCCTGG + Intergenic
1114568612 14:23650090-23650112 ATAAGCATTCTGGTAAACTGGGG + Intergenic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1114927308 14:27420654-27420676 ACAGGAAATGTGGGAAAGTTAGG - Intergenic
1115022849 14:28704005-28704027 AGAAGCAAAATGGGAAAGTAGGG - Intergenic
1115418672 14:33166942-33166964 AGGAGCAATATAGGAAAGTTTGG - Intronic
1117150006 14:52876814-52876836 ATAAGGAAACTGTGAAAGTATGG - Intronic
1118575731 14:67240184-67240206 ATAACAAATCTGGGAAGGGTAGG + Intergenic
1119063303 14:71498952-71498974 AAAAGCATTTTGGGAAAATTAGG + Intronic
1119132745 14:72190021-72190043 ATAGGTTGTCTGGGAAAGTTTGG - Intronic
1120060602 14:79978142-79978164 ACATGAAATGTGGGAAAGTTTGG + Intergenic
1120259003 14:82158938-82158960 ATTATCAATTTGGTAAAGTTAGG - Intergenic
1123858988 15:24444111-24444133 ATAAGAGCTCTGGGAAAGTTAGG - Intergenic
1125578714 15:40771236-40771258 AGAGGCAATCTGGAAATGTTGGG + Exonic
1125968071 15:43890218-43890240 ACAAGCAAGCTAGGAAAGTAAGG + Intronic
1126065993 15:44826871-44826893 AGATACAATCTGGGATAGTTTGG - Intergenic
1126093842 15:45073695-45073717 AGATACAATCTGGGATAGTTTGG + Exonic
1126980102 15:54231601-54231623 ATAAGCACTCTGTAAATGTTGGG + Intronic
1128683834 15:69669322-69669344 AGCAGCTATCTGGGAGAGTTTGG + Intergenic
1128706082 15:69838220-69838242 ATATTCACTTTGGGAAAGTTTGG - Intergenic
1129958669 15:79663021-79663043 CTAAGCAAACTGAGATAGTTTGG - Intergenic
1133625312 16:7565352-7565374 AAAAGCAATCGAGAAAAGTTCGG - Intronic
1134407629 16:13975778-13975800 ATAGGCAAACTGGGTAATTTTGG + Intergenic
1135129206 16:19838340-19838362 TTTGGCAATTTGGGAAAGTTTGG + Intronic
1139621474 16:68147965-68147987 AAAAGGAAACTGGAAAAGTTTGG - Intronic
1139838182 16:69856836-69856858 AAAAGGAAGCTGGGATAGTTAGG - Intronic
1143983300 17:10889485-10889507 AAAACCACTTTGGGAAAGTTTGG + Intergenic
1147342640 17:39763082-39763104 ATAAGCAATCTGGCATAGCTTGG + Intergenic
1147535745 17:41321833-41321855 ATAAGTAAGGTGGGAAAGATGGG - Intergenic
1147887769 17:43696197-43696219 ATTTGCAAACTGGGAGAGTTTGG + Intergenic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1158079283 18:53569674-53569696 ATAGCTAATCTGGAAAAGTTTGG + Intergenic
1158897711 18:61930746-61930768 ATAAGCAATTTGGAATAATTTGG - Intergenic
1161897689 19:7094827-7094849 ATCAGCAATATGGGAAAATTGGG - Intergenic
1162538459 19:11278214-11278236 ATGCACAATCTGGAAAAGTTAGG - Intergenic
1164913882 19:32034303-32034325 ATGAACAATCCAGGAAAGTTCGG - Intergenic
1165664938 19:37620180-37620202 ACAAGGAATCTTGGAAAATTAGG + Intronic
1166430407 19:42721357-42721379 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166451113 19:42901801-42901823 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166463129 19:43007371-43007393 CTAAAAAATCTGGGCAAGTTCGG - Intronic
1166469274 19:43063924-43063946 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1166480406 19:43167458-43167480 CTAAAAAATCTGGGCAAGTTCGG - Intronic
1166490225 19:43253001-43253023 GTAAAAAATCTGGGCAAGTTCGG - Intronic
1167932597 19:52878678-52878700 AAAATGAATCTGGTAAAGTTTGG - Exonic
1167985289 19:53309445-53309467 GTAAGGAATCTGGGAAACTCAGG - Intergenic
1168560060 19:57374891-57374913 ACAGGAAATGTGGGAAAGTTTGG - Intronic
926287850 2:11504746-11504768 ATAAGCAATCAAGCAATGTTTGG - Intergenic
927355587 2:22169317-22169339 ATCAGCAAACAGTGAAAGTTTGG - Intergenic
929036649 2:37699600-37699622 AGTAGCAATTTGGGAGAGTTAGG + Intronic
929938044 2:46309183-46309205 ATAAGCAATGAGGATAAGTTAGG - Intronic
930310450 2:49732994-49733016 ACAGGAAATGTGGGAAAGTTTGG - Intergenic
930988607 2:57622003-57622025 ATAAGCAATAAGGGAAAGTTAGG - Intergenic
932023637 2:68112851-68112873 ATGAGCAACCTGGGAAAGTGAGG - Intergenic
932064088 2:68534733-68534755 ATAAGCAATGTGGGATGCTTAGG + Intronic
933789167 2:85870062-85870084 ATAAGCAATTTTGGTAAGTAGGG - Intronic
935481360 2:103594116-103594138 ACAGGAAATGTGGGAAAGTTTGG + Intergenic
936037733 2:109126274-109126296 AGAAGAAAGCTGGGAAAGGTGGG + Intergenic
937069128 2:119049471-119049493 ATAAAAAATTTGGGAAACTTTGG - Intergenic
937701100 2:124863759-124863781 ATTGGCAGTCTGGGAAAGATGGG + Intronic
939830325 2:147063667-147063689 ACAGTCAATGTGGGAAAGTTTGG + Intergenic
940143674 2:150523016-150523038 ACAGGAAATGTGGGAAAGTTTGG + Intronic
940426577 2:153538048-153538070 AGAAGAAATGTGGGAAAGTTTGG + Intergenic
943305337 2:186254824-186254846 AGAAGCAATATGGAATAGTTGGG + Intergenic
944231654 2:197400309-197400331 ATAACAAATCTGCTAAAGTTAGG - Exonic
944652688 2:201847624-201847646 ATAAGCACCCTGGGAATGTGTGG + Intronic
945773780 2:214079491-214079513 ATAAGCCATGTTAGAAAGTTTGG + Intronic
947308705 2:228776732-228776754 ATAAGCAATCAAGGAAAGAAAGG + Intergenic
1170039620 20:12026182-12026204 ATAAGCAAGCTGTGAATATTTGG - Intergenic
1170450404 20:16477613-16477635 ATAAACATTCTGGGTAAGTGAGG + Intronic
1174784636 20:53420994-53421016 GAAACCAATCTGGGAAACTTTGG + Intronic
1174950937 20:55040981-55041003 ATAAAAAATGTGGAAAAGTTTGG + Intergenic
1176320314 21:5311354-5311376 AGAAGCAATCTGAGAAACTTTGG + Intergenic
1176477779 21:7243076-7243098 AGAAGCAATCTGAGAAACTTTGG + Intergenic
1177028944 21:15957824-15957846 ATAATTAAACTGGGAAAGTCTGG + Intergenic
1177948910 21:27509526-27509548 AGAAGCAATCTGGATATGTTAGG - Intergenic
1178380696 21:32105258-32105280 ATTTGCAAGCTGAGAAAGTTGGG - Intergenic
951403771 3:22268848-22268870 ATAAGGAAACTGAGAAAATTGGG - Intronic
951803030 3:26617910-26617932 ATAAGAAAACTGGGAGGGTTGGG - Intergenic
952025719 3:29079110-29079132 ATAAGCAAATTGGGATAGTTAGG - Intergenic
954282610 3:49593473-49593495 ACAATCAATCTGGAAAAGCTTGG - Intronic
956560828 3:70572358-70572380 ATAAGCATTCTGCGAAAGTCTGG + Intergenic
956670203 3:71681984-71682006 TTAAGAAATGTGGAAAAGTTGGG + Exonic
957658901 3:83120663-83120685 AGGAGCAATCATGGAAAGTTTGG - Intergenic
957912660 3:86641873-86641895 CTAAACTATCTGGGATAGTTTGG - Intergenic
957964675 3:87306980-87307002 ATAAGTAATCTGGGAAGCTGAGG - Intergenic
958065850 3:88544284-88544306 ACAGGAAATGTGGGAAAGTTTGG + Intergenic
960647262 3:119900571-119900593 ATAAGCAATCTAGGAAGTTTTGG - Intronic
961157045 3:124688683-124688705 ATAAGGAATTTGGGAAAAATGGG + Intronic
961995028 3:131233259-131233281 GTAAGCACTATGGGGAAGTTAGG - Intronic
962234187 3:133693687-133693709 ATATGCCTTCTGGAAAAGTTGGG - Intergenic
965774869 3:172218212-172218234 CTAGGAAATCTTGGAAAGTTAGG - Intronic
966314921 3:178634152-178634174 ATAGGAAATGTGGGAAAGTTTGG - Intronic
967559079 3:190896613-190896635 ATAAGAAATTTAGGAAACTTTGG + Intergenic
968011791 3:195286369-195286391 ATAAGCAATATGGTAATGTTAGG - Intronic
972048226 4:34695381-34695403 ATAAGCAAAGAGGGATAGTTCGG + Intergenic
972850089 4:43038027-43038049 ATAAGGAAACTGTAAAAGTTCGG - Intergenic
974525409 4:63043943-63043965 AGAAGAAATATGGGAAAGTTTGG - Intergenic
975239622 4:72042497-72042519 ATAAGAAATGTGGGAAAGTTTGG + Intronic
975361392 4:73475802-73475824 ACAGGAAATGTGGGAAAGTTTGG - Intergenic
975660431 4:76683304-76683326 ATAAGTTACCTGGGAAAGGTGGG - Intronic
976675101 4:87694340-87694362 ATAGGCAATCTGATCAAGTTAGG - Intergenic
977821131 4:101473431-101473453 TAAAAAAATCTGGGAAAGTTTGG + Intronic
980481503 4:133394377-133394399 ATAAGCTATATGGAAAACTTTGG - Intergenic
981042247 4:140233886-140233908 ATAAGAAATCAGTGAAATTTAGG - Intergenic
983469490 4:168139035-168139057 ATCAGCAAACTGAGATAGTTTGG + Intronic
983477251 4:168229336-168229358 ATAAGCACTCTGGGCACTTTCGG + Intronic
984168858 4:176336906-176336928 AAAACCACTTTGGGAAAGTTTGG - Intergenic
984188229 4:176572585-176572607 TTCAGCAATCTGGTAAATTTTGG - Intergenic
986105606 5:4656655-4656677 GGAAGAAATGTGGGAAAGTTTGG - Intergenic
986786336 5:11117669-11117691 ATAAGCATTCTGAAAAAGTGGGG - Intronic
987016622 5:13826850-13826872 TGAAGAAATGTGGGAAAGTTTGG + Intronic
987098578 5:14572306-14572328 GTAAATAATTTGGGAAAGTTTGG + Intergenic
987562486 5:19541336-19541358 AAAAAAAATGTGGGAAAGTTTGG - Intronic
988129393 5:27082740-27082762 ATAAGAAATATGAGAAACTTAGG - Intronic
988512572 5:31878162-31878184 ATAAGCAATCTGAGCATGTGAGG - Intronic
988855060 5:35220255-35220277 AGAAGCAATGAGGGAAAGGTGGG - Intronic
989484950 5:41978690-41978712 AGAAAAAATTTGGGAAAGTTAGG - Intergenic
990620886 5:57557374-57557396 ATAAGCACTCTGGTATGGTTGGG + Intergenic
991420500 5:66436559-66436581 ATAAACAATCCAGGAAAGCTAGG + Intergenic
991642515 5:68769114-68769136 ATAAGAGCTTTGGGAAAGTTGGG + Intergenic
993296669 5:86149623-86149645 CTAAGTAAGCTGGGAAATTTGGG + Intergenic
994702036 5:103145929-103145951 ATAATCAAACTGGAATAGTTGGG - Intronic
995283096 5:110357278-110357300 AGAAGATATGTGGGAAAGTTTGG + Intronic
995744419 5:115389202-115389224 GTAAGCAATCTGGGCATCTTAGG - Intergenic
996239365 5:121176189-121176211 ATAAGCAAACTTGGCGAGTTTGG - Intergenic
997116132 5:131127428-131127450 ACATGCAATCTGTGAAGGTTTGG - Intergenic
998120451 5:139572219-139572241 ATAAGCATTCTAATAAAGTTGGG - Intronic
999238765 5:150115473-150115495 ATATGTAAAATGGGAAAGTTAGG - Exonic
1000252785 5:159511014-159511036 ATAACCAATATGGAAAAGATTGG + Intergenic
1000532891 5:162445162-162445184 ATTATCAATTTGGGAAAGATAGG + Intergenic
1004287552 6:14336438-14336460 ATAGCCAATTTAGGAAAGTTTGG - Intergenic
1004928470 6:20438724-20438746 ATAACCAATCTGGGCAATTTGGG + Intronic
1005954944 6:30657147-30657169 AAAAGTAATCTTGGAAAGTTAGG + Intronic
1006244692 6:32721063-32721085 AGAGGCATTCTGGTAAAGTTTGG + Intergenic
1006763815 6:36487135-36487157 AGAAGCCATCTGAGAAAGTGGGG - Exonic
1006965071 6:37975061-37975083 ATAACCACTTTGGAAAAGTTTGG - Intronic
1007586262 6:42991854-42991876 ACAAGCAATCTGGGAAAGGAGGG + Intronic
1008331746 6:50253768-50253790 GCAAGCATTCTGGGACAGTTAGG - Intergenic
1008411857 6:51189605-51189627 ATAAGCAAACAGGGACAATTTGG + Intergenic
1008648094 6:53535879-53535901 ATAACCACCCTGGAAAAGTTTGG + Intronic
1008711271 6:54230171-54230193 ATAAGGAATCAGGGAAGGGTGGG - Intronic
1009518506 6:64651886-64651908 ATAAGCAATATGATAAAGATTGG - Intronic
1010615792 6:78010680-78010702 ATGTGAAATCTGGGAAATTTGGG - Intergenic
1012723766 6:102783048-102783070 ACAAGAAATGTGGAAAAGTTTGG + Intergenic
1012749152 6:103135483-103135505 ATAATCAATGTGGGAAAGTTTGG - Intergenic
1014041609 6:116833611-116833633 ATAAGCCAGCTGGGCAAGTACGG - Intergenic
1014084176 6:117323551-117323573 ATAAGCAAACTCGGACAGTTTGG + Intronic
1014266992 6:119290496-119290518 ATGAGCAAGCTGGGAAAGTTTGG - Intronic
1014756998 6:125312408-125312430 ATAATCAGTCTAGGAGAGTTTGG - Intergenic
1015713211 6:136163940-136163962 ACAGGAAATGTGGGAAAGTTTGG - Intronic
1018554481 6:165035706-165035728 ACAAGAAAAGTGGGAAAGTTTGG + Intergenic
1021026771 7:15677600-15677622 AGAAGCCTTCTGGAAAAGTTGGG - Intronic
1025748659 7:64271193-64271215 AAAAGAAATGTGGGAGAGTTTGG + Intergenic
1026216258 7:68352005-68352027 ATAAGTTATCTGGGGGAGTTTGG - Intergenic
1027950308 7:84807158-84807180 ATAAGGAATCTGGGAAAATCAGG - Intergenic
1028151730 7:87381365-87381387 TTAAGAAATGTGGGAAAGATAGG - Intronic
1030554157 7:111002420-111002442 ATGAGGAATTTGGGAGAGTTTGG + Intronic
1032184524 7:129712723-129712745 CTAAGGAGCCTGGGAAAGTTTGG + Intronic
1033792581 7:144809055-144809077 CCAAGTAATCTGGGTAAGTTAGG - Intronic
1039429472 8:37514583-37514605 ACAAGCAATCAGGGAAGCTTTGG + Intergenic
1039435057 8:37554263-37554285 GAAAGCCATCTGGGGAAGTTGGG - Intergenic
1040454814 8:47586324-47586346 ATAACTACTCTGGAAAAGTTTGG - Intronic
1041603341 8:59749850-59749872 AGAAGCAATCCGGAAAAGTGTGG + Intergenic
1042578100 8:70244460-70244482 AAGATCAATCTGAGAAAGTTAGG + Intronic
1042741241 8:72049561-72049583 ATAAGCAATCTGGGAAAGTTGGG - Intronic
1042756886 8:72224393-72224415 ATAAAAGATCTAGGAAAGTTGGG - Intergenic
1043940541 8:86190969-86190991 ATAAAAAATGTAGGAAAGTTTGG - Intergenic
1044110770 8:88270314-88270336 AGAAGCAATCTGATAAATTTTGG - Intronic
1044751961 8:95424842-95424864 AAAAGGAATCGGGGAAATTTTGG - Intergenic
1045106955 8:98901859-98901881 ATAGGCAAGCTGGGAAAGAATGG + Intronic
1045732348 8:105256672-105256694 AGAAAAAATGTGGGAAAGTTTGG - Intronic
1045846453 8:106642637-106642659 AAAAGGAATCTGGGAAATGTAGG + Intronic
1046583502 8:116122744-116122766 GAAAGCATTCTGGGAAACTTCGG + Intergenic
1046882036 8:119319958-119319980 ACAGGAAATGTGGGAAAGTTTGG - Intergenic
1050909863 9:11055140-11055162 AAAAAAAATGTGGGAAAGTTTGG + Intergenic
1052893447 9:33724987-33725009 ATAGCCAGTCTGGAAAAGTTTGG - Intergenic
1053549547 9:39061781-39061803 ATAAGCGATCTTGGAGAGCTAGG + Intergenic
1053813660 9:41881856-41881878 ATAAGCAATCTTGGAGAGCTAGG + Intergenic
1054616936 9:67305583-67305605 ATAAGCAATCTTGGAGAGCTAGG - Intergenic
1055584230 9:77740444-77740466 ATAGGCAATCAGAGTAAGTTTGG + Intronic
1056039628 9:82649614-82649636 ATAGCCATTTTGGGAAAGTTTGG - Intergenic
1061795914 9:133085806-133085828 ATTAGCAATCTGAAAAAGATAGG + Intronic
1186061422 X:5711950-5711972 CTAACCAATTTGGAAAAGTTTGG + Intergenic
1186264221 X:7814178-7814200 AGAAACAATTAGGGAAAGTTAGG + Intergenic
1187395685 X:18917123-18917145 CTGAGCAATCTGGGAAACTGAGG - Intronic
1188102482 X:26106864-26106886 ATCAGCAATCTGGCAGAGTATGG - Intergenic
1188464360 X:30462450-30462472 ATAGGCATCTTGGGAAAGTTTGG - Intergenic
1188997510 X:36904198-36904220 AGAAAAAATGTGGGAAAGTTTGG + Intergenic
1190580437 X:51888534-51888556 ATGATCACTCTAGGAAAGTTTGG + Intronic
1191604605 X:63046688-63046710 ATACTAAATCTGGGAATGTTTGG + Intergenic
1191975215 X:66863980-66864002 ATAAGCATTCTGGGAAACCTAGG - Intergenic
1192553003 X:72068958-72068980 AACAGAAATCTGGGAAAATTTGG - Intergenic
1193388095 X:80894469-80894491 ATAAGAAAAGTGGGAAAGTTTGG + Intergenic
1193541935 X:82782756-82782778 ATAAAAAATGTAGGAAAGTTTGG - Intergenic
1194036618 X:88882665-88882687 ATAAGCTATTTGTAAAAGTTTGG - Intergenic
1194910183 X:99631748-99631770 AGAAGGAAGATGGGAAAGTTTGG - Intergenic
1195363793 X:104108557-104108579 ATAAGCAATCTAGGAGAGCCTGG + Intronic
1195549315 X:106149179-106149201 ATAGCCACTCTGGAAAAGTTTGG + Intergenic
1196050385 X:111298060-111298082 AAAAGCCATCTCAGAAAGTTAGG + Exonic
1196309408 X:114144882-114144904 TTAATCCATCTGGGAAAGTAAGG + Intergenic
1197301042 X:124781088-124781110 ATAAGTAATATGGGACAGTAAGG - Intronic
1197560621 X:128015761-128015783 ATAGAAAATGTGGGAAAGTTTGG - Intergenic
1198592078 X:138194881-138194903 AGAAGCAAACTGGGTAAGATGGG - Intergenic
1198663058 X:138991691-138991713 ACAATCAATAAGGGAAAGTTTGG + Intronic
1199203502 X:145121021-145121043 AAAAGTTATCTTGGAAAGTTAGG + Intergenic
1199449391 X:147962469-147962491 ATCAGGAGTCTGGGGAAGTTTGG + Intergenic
1199646088 X:149914099-149914121 ACAACCACTATGGGAAAGTTTGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic