ID: 1042741374

View in Genome Browser
Species Human (GRCh38)
Location 8:72050912-72050934
Sequence CAGCTGTTGTACAGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042741374_1042741375 0 Left 1042741374 8:72050912-72050934 CCTTCTGTTCTGTACAACAGCTG 0: 1
1: 0
2: 3
3: 19
4: 163
Right 1042741375 8:72050935-72050957 AAACTCAAGATTATTTCTTTAGG 0: 1
1: 1
2: 5
3: 51
4: 476
1042741374_1042741377 2 Left 1042741374 8:72050912-72050934 CCTTCTGTTCTGTACAACAGCTG 0: 1
1: 0
2: 3
3: 19
4: 163
Right 1042741377 8:72050937-72050959 ACTCAAGATTATTTCTTTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 241
1042741374_1042741376 1 Left 1042741374 8:72050912-72050934 CCTTCTGTTCTGTACAACAGCTG 0: 1
1: 0
2: 3
3: 19
4: 163
Right 1042741376 8:72050936-72050958 AACTCAAGATTATTTCTTTAGGG 0: 1
1: 0
2: 3
3: 41
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042741374 Original CRISPR CAGCTGTTGTACAGAACAGA AGG (reversed) Intronic
903048504 1:20583424-20583446 CAGATATTTTACAGAAGAGATGG - Intergenic
905902015 1:41588004-41588026 CAGCTGCTGGACAGAAGAAAGGG + Intronic
906041077 1:42788201-42788223 CAGCTCTTGTCCAGACCAGATGG + Intronic
906718293 1:47986858-47986880 CAGCCGCTGAACAGAACTGAAGG + Intronic
906843904 1:49169324-49169346 CAGTTGTTATACAGATCAGGAGG - Intronic
908109765 1:60885063-60885085 CCACTGTAGTACAGCACAGAAGG - Intronic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
911577872 1:99599669-99599691 CAGCTGCTGCTCAGAACTGATGG - Intergenic
912106896 1:106289722-106289744 CAGCTGTTGGACAAAGCACAGGG - Intergenic
912188403 1:107308435-107308457 CAGCTGTGGCAAAGATCAGATGG + Intronic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
912454710 1:109789731-109789753 TAACTCTTGCACAGAACAGAGGG - Intergenic
912729685 1:112091184-112091206 CATCTGTTGTACAGACCAACAGG - Intergenic
921800813 1:219399916-219399938 CAGCTGATGTAGAGACCAGCGGG - Intergenic
923368199 1:233284521-233284543 CAGGTGCTGTACAGTAAAGATGG - Intronic
923478813 1:234363402-234363424 CACCTCTTGTACAGAGCATACGG - Intergenic
924510270 1:244724205-244724227 CAGCTGCTGTGGAAAACAGAAGG + Intergenic
1071761555 10:88613387-88613409 AAGTGGTTGTAGAGAACAGAAGG + Intergenic
1074475714 10:113772249-113772271 CAGCTGTAATACAAGACAGAGGG + Intronic
1075921655 10:126218412-126218434 CAGCTGGTGAACAGAACAGCTGG + Intronic
1078119880 11:8496415-8496437 CTGCTATTATACAAAACAGACGG - Intronic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1083004835 11:59333865-59333887 CAGCAGATGTCCAGAAAAGACGG + Intergenic
1083121389 11:60515789-60515811 AGGCTGTTATTCAGAACAGATGG + Intronic
1083277133 11:61603243-61603265 CAGCTGTTGCACAGATGTGAGGG + Intergenic
1083314404 11:61805358-61805380 CAGCTGTGGGACGGAACAGAGGG + Intronic
1083792945 11:64997508-64997530 TGGCTGTTGGATAGAACAGATGG + Intergenic
1087188086 11:95223447-95223469 CAGCTGTTGCACAGTACTAAAGG + Intronic
1087231172 11:95666969-95666991 AAGCTGTTGTAAAGAAAACATGG - Intergenic
1087533625 11:99415506-99415528 CAGCTGTTATGCAGAAAAGAGGG + Intronic
1087996915 11:104820776-104820798 CAGCAGGTGTATAGAACAGTTGG - Intergenic
1089271093 11:117301717-117301739 CTGCTGACCTACAGAACAGATGG - Intronic
1091669051 12:2439294-2439316 CAGCGTTTGAACAGTACAGAGGG - Intronic
1092536383 12:9391866-9391888 CAGCTATCTTACAGAACAGCAGG + Intergenic
1095698741 12:45169193-45169215 CACCTGTTGTGGAGAACAGCTGG + Intergenic
1099604818 12:84790254-84790276 CAGGTGGTGTACAGAGCAGGTGG - Intergenic
1104530065 12:129561431-129561453 CAGCTGTTCTTCATAGCAGAGGG + Intronic
1104896126 12:132164696-132164718 CATCTCCTGCACAGAACAGATGG - Intergenic
1106791111 13:33155297-33155319 CAGGTGTTGTTCAGAATTGAGGG - Intronic
1107373856 13:39781189-39781211 GAGCTGTTTTAGAGAAGAGAAGG + Intronic
1108041602 13:46344358-46344380 TAGCTGTTGTAGAGACCACATGG - Intronic
1109151197 13:58849171-58849193 CAGCAGTTATACAAAAAAGAAGG - Intergenic
1111562448 13:89968752-89968774 CATCTTTGGAACAGAACAGAAGG - Intergenic
1111910627 13:94307709-94307731 CAGCTGTTTTAAAGAAATGATGG + Intronic
1112373799 13:98819973-98819995 CTGTTGTTTTACAGAACAGCAGG - Intronic
1112935612 13:104794472-104794494 CAGCTGTCTTACCAAACAGAAGG + Intergenic
1114067173 14:19071140-19071162 CAGATGGAGTTCAGAACAGATGG + Intergenic
1114095089 14:19328888-19328910 CAGATGGAGTTCAGAACAGATGG - Intergenic
1114166822 14:20227053-20227075 CTGCTGTTATACACGACAGATGG + Intergenic
1116986746 14:51228067-51228089 CATCTGTTATACAGAAATGATGG - Intergenic
1119432157 14:74575518-74575540 CAGCTGTTGGACACAACACCAGG - Intronic
1119498215 14:75099474-75099496 CAGCAGCAGTACAGAAGAGAAGG + Intronic
1121608924 14:95262292-95262314 CTTCTGTTGAACAGAACAGCTGG - Intronic
1125854683 15:42937580-42937602 CAGCTGCTTTAAAAAACAGATGG - Intergenic
1126225157 15:46261821-46261843 CAGCTGATGTGCAGATCAGAGGG - Intergenic
1126236562 15:46391902-46391924 AAGCTATTGTACAGCAAAGAAGG + Intergenic
1126442703 15:48708578-48708600 CAGCTGTTGAAATGATCAGATGG + Intergenic
1126936194 15:53711160-53711182 CAGCCTTTGTACAAAACAGCAGG - Intronic
1127431383 15:58912699-58912721 CAGATATTATACAGAACACAAGG - Intronic
1128842811 15:70863942-70863964 CAGCTGATGAGCAGCACAGAAGG - Intronic
1133412769 16:5581998-5582020 CAGCAGTTGTTTCGAACAGAAGG + Intergenic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1137918548 16:52460425-52460447 AGCCTGTTGTACATAACAGAAGG - Intronic
1137956143 16:52832015-52832037 TAGCTGTTGGACAGAAGAAAGGG - Intergenic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1138176342 16:54901496-54901518 CAGATCTTGTTAAGAACAGATGG - Intergenic
1139124664 16:64063718-64063740 CATCTGTGATACAGAACTGAAGG - Intergenic
1139807948 16:69585394-69585416 CAGCTGTTGTGAAAAACAGGTGG + Intronic
1143217667 17:5237237-5237259 CACATGTTCTACAGGACAGAAGG + Intergenic
1146470547 17:33121029-33121051 GAGCTGTTGTAAAGATCAAAAGG + Intronic
1147755291 17:42763273-42763295 CAGCTGCTGTCCAGACCGGAAGG - Intergenic
1151283035 17:73090725-73090747 GGGCTGGTGAACAGAACAGAGGG + Intronic
1152891351 17:82883376-82883398 CAGGCGTTGCACAGAACACAGGG - Intronic
1158234003 18:55292455-55292477 CAGCAGTTTTACACAACAAAAGG + Intronic
1158562909 18:58530600-58530622 AACCTGTTGTACCGAACACAAGG + Intronic
1158957668 18:62555872-62555894 CAGTTGTTTTTCTGAACAGAAGG + Intronic
1161976542 19:7610857-7610879 CAGCTGCAGTACAGAGAAGAGGG - Exonic
1162828134 19:13266936-13266958 CAGTTCTTGCAGAGAACAGAAGG - Intronic
1163729992 19:18943384-18943406 CATTTTTTGCACAGAACAGACGG - Intergenic
1165156422 19:33791597-33791619 CAGCTGTTGTTTAGAGCTGATGG - Intergenic
1168238837 19:55079271-55079293 CAGCTGTTGTGCTGGACAGTGGG + Intronic
930930300 2:56874579-56874601 CAGCTGTTGTGGAGCCCAGAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933743763 2:85555112-85555134 CAGCTGATGTACTGAGAAGATGG - Intronic
936956112 2:118023954-118023976 CAGCTGTTGGACAGCCCAGAGGG - Intergenic
937399315 2:121568083-121568105 CAGCACCAGTACAGAACAGAGGG + Intronic
937919778 2:127120929-127120951 CAGCAGTCCTACAGAACAGAAGG - Intergenic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
942829985 2:180228229-180228251 TGGCTTTTGTACAGAACACAGGG - Intergenic
944944950 2:204673188-204673210 CTGCTGATGTACAGCACAGCAGG - Intronic
945951107 2:216039772-216039794 AAGCTGTTGGAAAGAAGAGATGG - Intronic
946156032 2:217807401-217807423 TACCTGATGTACAGAAGAGAGGG - Intronic
946380193 2:219342618-219342640 CAGCTGTGGTATAGATCAGAGGG - Intergenic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
1177239890 21:18443225-18443247 CTGCTCTCGTAGAGAACAGAGGG + Intronic
1178121850 21:29477321-29477343 CAGCTGTTGTCCAGAAGGGTTGG + Intronic
1180485613 22:15793171-15793193 CAGATGTTGCTCAGAGCAGATGG + Intergenic
1180485649 22:15793707-15793729 CAGATGGAGTTCAGAACAGATGG + Intergenic
1181178482 22:21051491-21051513 CAGCTGTGGTAGAGAGGAGATGG - Intronic
1184972500 22:48036285-48036307 CAGCTTTACCACAGAACAGATGG + Intergenic
951355369 3:21660673-21660695 GGGTTGTTGTTCAGAACAGAAGG - Intronic
953490578 3:43347048-43347070 AAGCTTTTGTATAGAAAAGATGG + Intronic
956002189 3:64741297-64741319 CAGCTCTTGTAGAGAATAGATGG + Intergenic
959279961 3:104325079-104325101 CAGCAGTAGCACAGAACAGACGG + Intergenic
959998674 3:112707053-112707075 CAGTTGTTTTAAAGATCAGATGG + Intergenic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
961091695 3:124118241-124118263 CAGCTGGGGGACAGGACAGAGGG + Intronic
965151741 3:164986356-164986378 CAGCTGTTACACAGAAAAGCAGG - Intronic
966649091 3:182279136-182279158 CAGCTGGTGAAGAGAGCAGAAGG - Intergenic
967381792 3:188867136-188867158 CAGCTGTAATACAGGAAAGAAGG - Intronic
968468631 4:765880-765902 CTTCTGTTGCTCAGAACAGAAGG + Intronic
972883809 4:43459704-43459726 CAACTGTGGAACAGAAGAGAAGG - Intergenic
973780138 4:54281139-54281161 CAGCTGATGCCCAGACCAGATGG + Intronic
974688743 4:65267625-65267647 TAGCTGTATTACAGAAAAGAGGG + Intergenic
978058085 4:104298236-104298258 TAGCTTTTGTGCAGAGCAGAGGG + Intergenic
982855731 4:160380135-160380157 CAGCTGAAGTAAAGATCAGAAGG - Intergenic
983562643 4:169116424-169116446 CAGCTGCTGCACAGGCCAGAGGG + Exonic
985372896 4:189305739-189305761 CAGCAGTTGTCGAGACCAGATGG + Intergenic
985617791 5:934539-934561 CTGATGCTGTACAGAACAGCTGG + Intergenic
987144122 5:14975279-14975301 CAGCTGCTTTACAGAACACCAGG - Intergenic
987332246 5:16867376-16867398 CAGATGGTGTACTGAACAGGAGG + Intronic
987754561 5:22084180-22084202 TAGCTGTTGTACAGAAAAGAGGG + Intronic
988705147 5:33718628-33718650 CTGCTGCTGTAAAGAATAGATGG + Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
993522411 5:88919722-88919744 CAAATGTTATACAGAACAGATGG + Intergenic
995684563 5:114758159-114758181 CAGGAGAAGTACAGAACAGAAGG + Intergenic
995861185 5:116642245-116642267 CAGCTGATGTACATAAAAGGTGG + Intergenic
995927453 5:117392101-117392123 CATCTTTTATACAAAACAGAAGG + Intergenic
998334102 5:141355593-141355615 CAGTTTTGGGACAGAACAGAGGG + Exonic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
999182935 5:149682823-149682845 CAGCCGTTGTGCAGAGCAGGAGG + Intergenic
999454972 5:151707698-151707720 CAGCTGTTCTAAAACACAGATGG - Intergenic
1001321199 5:170683407-170683429 TACTTGGTGTACAGAACAGAGGG - Intronic
1001924896 5:175628888-175628910 GAGATCTTGTACAGAACACATGG - Intergenic
1003893213 6:10581800-10581822 CAGGTCTTGTGGAGAACAGAAGG - Intronic
1004200041 6:13539918-13539940 CAGCTGCTTTAGAAAACAGATGG + Intergenic
1008203521 6:48623136-48623158 CACCTGTTGTACCCAACATATGG - Intergenic
1008332462 6:50260682-50260704 CAGCTGATGTGAAGACCAGAGGG - Intergenic
1010299614 6:74244315-74244337 CAGCTGATGTCCACCACAGAGGG - Intergenic
1010661846 6:78580699-78580721 CAGCTGTTCTAAAAAACATAAGG + Intergenic
1012796279 6:103766089-103766111 GAGCTGTAGAAAAGAACAGATGG + Intergenic
1013465536 6:110414377-110414399 CATCTGTAACACAGAACAGATGG + Intronic
1017045468 6:150343567-150343589 CAGCAGTTGTTCACAATAGATGG - Intergenic
1019311679 7:364959-364981 CAGCTGATGTACAGCTCAGGAGG - Intergenic
1020426388 7:8070918-8070940 CAGCCGTTGGACATACCAGATGG + Exonic
1022449755 7:30504202-30504224 AAGGTTATGTACAGAACAGAAGG + Intronic
1022728682 7:33003279-33003301 CAGGGGTGGGACAGAACAGATGG - Intronic
1025044965 7:55684710-55684732 CAGGGGTGGGACAGAACAGACGG + Intergenic
1030468490 7:109933350-109933372 CAGCTGTTGTCTAGAACATCTGG - Intergenic
1031794753 7:126157501-126157523 GTGCTGTTGTTCAGAACATATGG - Intergenic
1032488474 7:132306089-132306111 CAGCTGGTGGTCAGGACAGAAGG + Intronic
1035745262 8:1957433-1957455 CTTCTGCTGTACAGAAGAGAAGG - Exonic
1036190507 8:6665559-6665581 CAGCTGTTACACAGAAAAGCAGG - Intergenic
1036584323 8:10108995-10109017 CAGCAGGTGTACTGAACAGATGG + Intronic
1038263851 8:26021338-26021360 CAGCTTCTGTATAGATCAGAAGG + Intronic
1038911827 8:31973486-31973508 CAGCTCTCTTACAGAATAGATGG + Intronic
1039602390 8:38851058-38851080 GAGCAGTTTTACAGAACAAAAGG - Exonic
1040382085 8:46882733-46882755 CAGCTGTGGTACTGCACATAAGG - Intergenic
1040550466 8:48433428-48433450 CAGCTGATGCTCAGAACAGAAGG + Intergenic
1041843899 8:62305028-62305050 CAGCTGGTTTAAAGATCAGAAGG + Intronic
1042381902 8:68125395-68125417 CACCTGTGGTATATAACAGATGG - Intronic
1042741374 8:72050912-72050934 CAGCTGTTGTACAGAACAGAAGG - Intronic
1042756976 8:72225414-72225436 CAACTGTTGTGCAGAACAGAAGG - Intergenic
1042976286 8:74473580-74473602 CAGCTTTGTTACAGATCAGATGG + Intronic
1043280732 8:78462473-78462495 CAGCTATTATACAGACCAGATGG + Intergenic
1046398431 8:113672373-113672395 CTGCTGCTGTACAGCATAGATGG - Intergenic
1048044655 8:130761738-130761760 CAGCAGTTGGCCAGAGCAGAAGG - Intergenic
1048085344 8:131171759-131171781 CAGTTGTTTTACAGAAGAAATGG - Intergenic
1048452140 8:134542743-134542765 CAGGTATTGTACAGAAGTGAGGG + Intronic
1048964990 8:139608773-139608795 CCACTGTTGTAGAGAAAAGATGG + Intronic
1053619620 9:39802245-39802267 CCGAGGTTGTACAGAACAGTGGG - Intergenic
1054264538 9:62905198-62905220 CCGAGGTTGTACAGAACAGTGGG + Intergenic
1057035706 9:91810521-91810543 CAGCTGAAGTGCAGAGCAGAGGG - Intronic
1058375121 9:104313939-104313961 AAGCTGTTGTACTGAACAGATGG + Intergenic
1060756598 9:126218678-126218700 CAGTTAATGGACAGAACAGAAGG - Intergenic
1186453892 X:9695709-9695731 CAGCTGGTGCAGAGTACAGAGGG + Intronic
1190491669 X:50988870-50988892 CAGCTGATGAGCAAAACAGAAGG + Intergenic
1192275394 X:69625114-69625136 CAGCTGTTGAACAGATTAGAGGG + Intronic
1193633482 X:83919283-83919305 AAGCTGTTTTACAGAAATGAGGG + Intergenic
1195483366 X:105373811-105373833 CAGCTTTGTTAAAGAACAGATGG + Intronic
1195890855 X:109693394-109693416 TAGCCGTAGTAAAGAACAGAAGG + Intronic
1196174692 X:112627862-112627884 CTGCTATTGTACAGAAAGGAAGG - Intergenic
1196494456 X:116307649-116307671 CAGCTGATGCACACCACAGAGGG - Intergenic
1199929806 X:152506692-152506714 CTGAGGTTGTACAGAACAGGGGG + Intergenic
1201392054 Y:13509430-13509452 CACCTGAACTACAGAACAGAAGG + Intergenic