ID: 1042742188

View in Genome Browser
Species Human (GRCh38)
Location 8:72062293-72062315
Sequence TTCAATGTCTGAGTTTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042742188_1042742197 28 Left 1042742188 8:72062293-72062315 CCACCCAAAACTCAGACATTGAA No data
Right 1042742197 8:72062344-72062366 GGTCAGAGATGCCTGCCATAAGG No data
1042742188_1042742194 7 Left 1042742188 8:72062293-72062315 CCACCCAAAACTCAGACATTGAA No data
Right 1042742194 8:72062323-72062345 GGGCCAGAACTCTCCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042742188 Original CRISPR TTCAATGTCTGAGTTTTGGG TGG (reversed) Intronic