ID: 1042742191

View in Genome Browser
Species Human (GRCh38)
Location 8:72062297-72062319
Sequence TTCCTTCAATGTCTGAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042742191_1042742194 3 Left 1042742191 8:72062297-72062319 CCAAAACTCAGACATTGAAGGAA No data
Right 1042742194 8:72062323-72062345 GGGCCAGAACTCTCCACTTTTGG No data
1042742191_1042742197 24 Left 1042742191 8:72062297-72062319 CCAAAACTCAGACATTGAAGGAA No data
Right 1042742197 8:72062344-72062366 GGTCAGAGATGCCTGCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042742191 Original CRISPR TTCCTTCAATGTCTGAGTTT TGG (reversed) Intronic