ID: 1042742194 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:72062323-72062345 |
| Sequence | GGGCCAGAACTCTCCACTTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042742188_1042742194 | 7 | Left | 1042742188 | 8:72062293-72062315 | CCACCCAAAACTCAGACATTGAA | No data | ||
| Right | 1042742194 | 8:72062323-72062345 | GGGCCAGAACTCTCCACTTTTGG | No data | ||||
| 1042742190_1042742194 | 4 | Left | 1042742190 | 8:72062296-72062318 | CCCAAAACTCAGACATTGAAGGA | No data | ||
| Right | 1042742194 | 8:72062323-72062345 | GGGCCAGAACTCTCCACTTTTGG | No data | ||||
| 1042742191_1042742194 | 3 | Left | 1042742191 | 8:72062297-72062319 | CCAAAACTCAGACATTGAAGGAA | No data | ||
| Right | 1042742194 | 8:72062323-72062345 | GGGCCAGAACTCTCCACTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042742194 | Original CRISPR | GGGCCAGAACTCTCCACTTT TGG | Intronic | ||