ID: 1042743289 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:72075447-72075469 |
| Sequence | GCCCCAGGTGCCCGCGCGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 169 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 14, 4: 152} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042743289_1042743291 | 2 | Left | 1042743289 | 8:72075447-72075469 | CCACGCGCGCGGGCACCTGGGGC | 0: 1 1: 1 2: 1 3: 14 4: 152 |
||
| Right | 1042743291 | 8:72075472-72075494 | GAGAGCGCTGTCAGCCTGCCAGG | 0: 1 1: 1 2: 10 3: 15 4: 131 |
||||
| 1042743289_1042743293 | 9 | Left | 1042743289 | 8:72075447-72075469 | CCACGCGCGCGGGCACCTGGGGC | 0: 1 1: 1 2: 1 3: 14 4: 152 |
||
| Right | 1042743293 | 8:72075479-72075501 | CTGTCAGCCTGCCAGGCGCTGGG | 0: 1 1: 1 2: 1 3: 20 4: 227 |
||||
| 1042743289_1042743294 | 10 | Left | 1042743289 | 8:72075447-72075469 | CCACGCGCGCGGGCACCTGGGGC | 0: 1 1: 1 2: 1 3: 14 4: 152 |
||
| Right | 1042743294 | 8:72075480-72075502 | TGTCAGCCTGCCAGGCGCTGGGG | 0: 1 1: 1 2: 3 3: 36 4: 352 |
||||
| 1042743289_1042743292 | 8 | Left | 1042743289 | 8:72075447-72075469 | CCACGCGCGCGGGCACCTGGGGC | 0: 1 1: 1 2: 1 3: 14 4: 152 |
||
| Right | 1042743292 | 8:72075478-72075500 | GCTGTCAGCCTGCCAGGCGCTGG | 0: 1 1: 1 2: 0 3: 21 4: 236 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042743289 | Original CRISPR | GCCCCAGGTGCCCGCGCGCG TGG (reversed) | Exonic | ||