ID: 1042743289

View in Genome Browser
Species Human (GRCh38)
Location 8:72075447-72075469
Sequence GCCCCAGGTGCCCGCGCGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042743289_1042743291 2 Left 1042743289 8:72075447-72075469 CCACGCGCGCGGGCACCTGGGGC 0: 1
1: 1
2: 1
3: 14
4: 152
Right 1042743291 8:72075472-72075494 GAGAGCGCTGTCAGCCTGCCAGG 0: 1
1: 1
2: 10
3: 15
4: 131
1042743289_1042743293 9 Left 1042743289 8:72075447-72075469 CCACGCGCGCGGGCACCTGGGGC 0: 1
1: 1
2: 1
3: 14
4: 152
Right 1042743293 8:72075479-72075501 CTGTCAGCCTGCCAGGCGCTGGG 0: 1
1: 1
2: 1
3: 20
4: 227
1042743289_1042743294 10 Left 1042743289 8:72075447-72075469 CCACGCGCGCGGGCACCTGGGGC 0: 1
1: 1
2: 1
3: 14
4: 152
Right 1042743294 8:72075480-72075502 TGTCAGCCTGCCAGGCGCTGGGG 0: 1
1: 1
2: 3
3: 36
4: 352
1042743289_1042743292 8 Left 1042743289 8:72075447-72075469 CCACGCGCGCGGGCACCTGGGGC 0: 1
1: 1
2: 1
3: 14
4: 152
Right 1042743292 8:72075478-72075500 GCTGTCAGCCTGCCAGGCGCTGG 0: 1
1: 1
2: 0
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042743289 Original CRISPR GCCCCAGGTGCCCGCGCGCG TGG (reversed) Exonic