ID: 1042745569

View in Genome Browser
Species Human (GRCh38)
Location 8:72102585-72102607
Sequence AACTCAGATGGATCCTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042745564_1042745569 29 Left 1042745564 8:72102533-72102555 CCTGTGGGTCTATATCTAGATGC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1042745569 8:72102585-72102607 AACTCAGATGGATCCTAATTAGG No data
1042745566_1042745569 4 Left 1042745566 8:72102558-72102580 CCTGTAGGTCTGACAAATATGTC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1042745569 8:72102585-72102607 AACTCAGATGGATCCTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042745569 Original CRISPR AACTCAGATGGATCCTAATT AGG Intronic
No off target data available for this crispr