ID: 1042748007

View in Genome Browser
Species Human (GRCh38)
Location 8:72128232-72128254
Sequence ACATGAACACACAAAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042748007_1042748011 14 Left 1042748007 8:72128232-72128254 CCTCATTCTTTGTGTGTTCATGT No data
Right 1042748011 8:72128269-72128291 GCCATGCAACAACAAACCTCAGG No data
1042748007_1042748008 -8 Left 1042748007 8:72128232-72128254 CCTCATTCTTTGTGTGTTCATGT No data
Right 1042748008 8:72128247-72128269 GTTCATGTCCTTGTTCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042748007 Original CRISPR ACATGAACACACAAAGAATG AGG (reversed) Intergenic
No off target data available for this crispr