ID: 1042749214

View in Genome Browser
Species Human (GRCh38)
Location 8:72139884-72139906
Sequence CTGCCAGAAGGGCAGTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042749214_1042749219 -1 Left 1042749214 8:72139884-72139906 CCCTAGTACTGCCCTTCTGGCAG No data
Right 1042749219 8:72139906-72139928 GAGTTCTCACAAGAGCTGGCTGG No data
1042749214_1042749220 13 Left 1042749214 8:72139884-72139906 CCCTAGTACTGCCCTTCTGGCAG No data
Right 1042749220 8:72139920-72139942 GCTGGCTGGTTAAAAGTGTGTGG No data
1042749214_1042749218 -5 Left 1042749214 8:72139884-72139906 CCCTAGTACTGCCCTTCTGGCAG No data
Right 1042749218 8:72139902-72139924 GGCAGAGTTCTCACAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042749214 Original CRISPR CTGCCAGAAGGGCAGTACTA GGG (reversed) Intergenic
No off target data available for this crispr