ID: 1042756802

View in Genome Browser
Species Human (GRCh38)
Location 8:72223159-72223181
Sequence CTGCAGAACTTGAGGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042756796_1042756802 10 Left 1042756796 8:72223126-72223148 CCAGGAGCTCCTGGGGCTTCTGG No data
Right 1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG No data
1042756798_1042756802 1 Left 1042756798 8:72223135-72223157 CCTGGGGCTTCTGGTGAATGTCA No data
Right 1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG No data
1042756792_1042756802 22 Left 1042756792 8:72223114-72223136 CCATCAATGCATCCAGGAGCTCC No data
Right 1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042756802 Original CRISPR CTGCAGAACTTGAGGGTAGA TGG Intergenic
No off target data available for this crispr