ID: 1042760494

View in Genome Browser
Species Human (GRCh38)
Location 8:72267084-72267106
Sequence ACCTATATGCCAAAGATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042760494_1042760496 3 Left 1042760494 8:72267084-72267106 CCCTTCATCTTTGGCATATAGGT No data
Right 1042760496 8:72267110-72267132 GTCTATCTGCCAGTCCTCCCTGG No data
1042760494_1042760501 30 Left 1042760494 8:72267084-72267106 CCCTTCATCTTTGGCATATAGGT No data
Right 1042760501 8:72267137-72267159 CTTCTCATTCTTTGTGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042760494 Original CRISPR ACCTATATGCCAAAGATGAA GGG (reversed) Intergenic
No off target data available for this crispr