ID: 1042761209

View in Genome Browser
Species Human (GRCh38)
Location 8:72273312-72273334
Sequence CTCCTGCAGTGGAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042761203_1042761209 5 Left 1042761203 8:72273284-72273306 CCTGAGGATCTGGGGTATCAACC No data
Right 1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG No data
1042761202_1042761209 6 Left 1042761202 8:72273283-72273305 CCCTGAGGATCTGGGGTATCAAC No data
Right 1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042761209 Original CRISPR CTCCTGCAGTGGAAACTGGG TGG Intergenic
No off target data available for this crispr