ID: 1042764066

View in Genome Browser
Species Human (GRCh38)
Location 8:72301465-72301487
Sequence AATGACTGCATGGTGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042764066_1042764072 13 Left 1042764066 8:72301465-72301487 CCTCAGTTCACCATGCAGTCATT No data
Right 1042764072 8:72301501-72301523 CGCAACCATAGAGCAAAAACAGG No data
1042764066_1042764074 28 Left 1042764066 8:72301465-72301487 CCTCAGTTCACCATGCAGTCATT No data
Right 1042764074 8:72301516-72301538 AAAACAGGCATTCTTCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042764066 Original CRISPR AATGACTGCATGGTGAACTG AGG (reversed) Intergenic