ID: 1042764739

View in Genome Browser
Species Human (GRCh38)
Location 8:72308729-72308751
Sequence GAATGGTCACTGGTGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042764739_1042764748 10 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764748 8:72308762-72308784 AGCAGCAGCAGTGGGGGTGTGGG No data
1042764739_1042764750 17 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764750 8:72308769-72308791 GCAGTGGGGGTGTGGGGAGCAGG No data
1042764739_1042764754 23 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764754 8:72308775-72308797 GGGGTGTGGGGAGCAGGGTGGGG No data
1042764739_1042764744 2 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764744 8:72308754-72308776 ACATTCACAGCAGCAGCAGTGGG No data
1042764739_1042764743 1 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764743 8:72308753-72308775 TACATTCACAGCAGCAGCAGTGG No data
1042764739_1042764752 21 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764752 8:72308773-72308795 TGGGGGTGTGGGGAGCAGGGTGG No data
1042764739_1042764745 3 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG No data
1042764739_1042764747 9 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG No data
1042764739_1042764746 4 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764746 8:72308756-72308778 ATTCACAGCAGCAGCAGTGGGGG No data
1042764739_1042764749 11 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764749 8:72308763-72308785 GCAGCAGCAGTGGGGGTGTGGGG No data
1042764739_1042764753 22 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764753 8:72308774-72308796 GGGGGTGTGGGGAGCAGGGTGGG No data
1042764739_1042764751 18 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764751 8:72308770-72308792 CAGTGGGGGTGTGGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042764739 Original CRISPR GAATGGTCACTGGTGGCTGT TGG (reversed) Intergenic
No off target data available for this crispr