ID: 1042764741

View in Genome Browser
Species Human (GRCh38)
Location 8:72308739-72308761
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042764741_1042764748 0 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764748 8:72308762-72308784 AGCAGCAGCAGTGGGGGTGTGGG No data
1042764741_1042764743 -9 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764743 8:72308753-72308775 TACATTCACAGCAGCAGCAGTGG No data
1042764741_1042764750 7 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764750 8:72308769-72308791 GCAGTGGGGGTGTGGGGAGCAGG No data
1042764741_1042764745 -7 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG No data
1042764741_1042764746 -6 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764746 8:72308756-72308778 ATTCACAGCAGCAGCAGTGGGGG No data
1042764741_1042764749 1 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764749 8:72308763-72308785 GCAGCAGCAGTGGGGGTGTGGGG No data
1042764741_1042764754 13 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764754 8:72308775-72308797 GGGGTGTGGGGAGCAGGGTGGGG No data
1042764741_1042764753 12 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764753 8:72308774-72308796 GGGGGTGTGGGGAGCAGGGTGGG No data
1042764741_1042764752 11 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764752 8:72308773-72308795 TGGGGGTGTGGGGAGCAGGGTGG No data
1042764741_1042764751 8 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764751 8:72308770-72308792 CAGTGGGGGTGTGGGGAGCAGGG No data
1042764741_1042764747 -1 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG No data
1042764741_1042764744 -8 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764744 8:72308754-72308776 ACATTCACAGCAGCAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042764741 Original CRISPR GTGAATGTATGAATGGTCAC TGG (reversed) Intergenic
No off target data available for this crispr