ID: 1042764745

View in Genome Browser
Species Human (GRCh38)
Location 8:72308755-72308777
Sequence CATTCACAGCAGCAGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042764739_1042764745 3 Left 1042764739 8:72308729-72308751 CCAACAGCCACCAGTGACCATTC No data
Right 1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG No data
1042764740_1042764745 -4 Left 1042764740 8:72308736-72308758 CCACCAGTGACCATTCATACATT No data
Right 1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG No data
1042764741_1042764745 -7 Left 1042764741 8:72308739-72308761 CCAGTGACCATTCATACATTCAC No data
Right 1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042764745 Original CRISPR CATTCACAGCAGCAGCAGTG GGG Intergenic
No off target data available for this crispr