ID: 1042766881

View in Genome Browser
Species Human (GRCh38)
Location 8:72331694-72331716
Sequence CGAGTACAACATCTTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042766877_1042766881 -5 Left 1042766877 8:72331676-72331698 CCGTAGGTTCTGGGGATTCGAGT No data
Right 1042766881 8:72331694-72331716 CGAGTACAACATCTTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042766881 Original CRISPR CGAGTACAACATCTTGGGGT AGG Intergenic
No off target data available for this crispr