ID: 1042770949

View in Genome Browser
Species Human (GRCh38)
Location 8:72381981-72382003
Sequence CTAGTACCACACAAAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042770949_1042770953 -2 Left 1042770949 8:72381981-72382003 CCCTTTTCTTTGTGTGGTACTAG No data
Right 1042770953 8:72382002-72382024 AGAAGGAAGTTAGGAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042770949 Original CRISPR CTAGTACCACACAAAGAAAA GGG (reversed) Intergenic
No off target data available for this crispr