ID: 1042776700

View in Genome Browser
Species Human (GRCh38)
Location 8:72440158-72440180
Sequence TCAGCTTGTACTCACCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042776692_1042776700 28 Left 1042776692 8:72440107-72440129 CCCAGGCCACACATGGGACAGGT No data
Right 1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG No data
1042776694_1042776700 22 Left 1042776694 8:72440113-72440135 CCACACATGGGACAGGTGCCGTT No data
Right 1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG No data
1042776693_1042776700 27 Left 1042776693 8:72440108-72440130 CCAGGCCACACATGGGACAGGTG No data
Right 1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG No data
1042776697_1042776700 4 Left 1042776697 8:72440131-72440153 CCGTTGTGAAGGTCTTCTGTGGT No data
Right 1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042776700 Original CRISPR TCAGCTTGTACTCACCAGGT AGG Intergenic
No off target data available for this crispr